SLC22A15 cdna clone

SLC22A15 cDNA Clone

Gene Names

SLC22A15; FLIPT1; PRO34686

Synonyms

SLC22A15; SLC22A15 cDNA Clone; SLC22A15 cdna clone

Ordering
Cat. Num. AAA1275285 For Research Use Only!

Sequence

atgggcatctaccagatgtacttgtgcttcctgctggccgtgctgctgcagctctacgtggccacggaggccatcctcattgcactggttggggccacgccatcctaccactgggacctggcagagctcctgccaaatcagagccacggtaaccagtcagctggtgaagaccaggcctttggggactggctcctgacagccaacggcagtgagatccataagcacgtgcatttcagcagcagcttcacctccatcgcctcggagtggtttttaattgccaacagatcctacaaagtcagtgcagcaagctcttttttcttcagtggtgtatttgttggagttatctcttttggtcagctttcagatcgcttcggaaggaaaaaagtctatctcacaggttttgctcttgacatcttatttgcaattgcaaatggattttccccctcatatgagttctttgcagtaactcgcttcctggtgggcatgatgaatggagggatgtcgctggtggcctttgtcttgcttaatgagtgtgtgggcaccgcctactgggcacttgcaggatcgattggcggcctcttctttgcagttggcattgcccaatatgccctgttaggatacttcatccgctcctggaggaccctagccattctggttaacctgcagggaacggtggtctttctcttatctttattcattcctgaatcacctcgttggttatactcccagggtcgactgagtgaggctgaagaggcgctgtacctcattgccaagaggaaccgcaaactcaagtgcacgttctcactaacacacccagccaacaggagctgcagggagactggaagtttcctggatctctttcgttaccgggtcctgttaggacacactttgatcctgatgttcatctggtttgtgtgcagcttggtgtattatggcctaactctgagtgcgggtgatctaggtggaagtatttatgccaacctggccctgtctggcctcatagagattcaatcttaccctctctgtatctacttgattaaccaaaaatggtttggtcggaagcgaacattatcagcatttctgtgcctaggaggactggcttgtcttattgtaatgtttcttccagaaaagaaagacacaggtgtgtttgcagtggtgaacagccattccttgtccttgctggggaagctgaccatcagtgctgcctttaacattgtttatatctacacctctgagctttaccctacagtcatcaggaatgttgggcttggaacttgttccatgttctcccgagttggtgggattattgctcccttcatcccctcactgaaatatgtgcaatggtctttaccattcattgtcttcggagccacgggtctgacctccggcctcctgagtttgttattgccggagacccttaacagtccgctgctagaaacattctccgaccttcaggtgtattcgtatcgcaggctgggagaagaagcattatctttacaggctttggacccccaacagtgtgtggacaaggagagctctttagggagtgagagtgaggaagaggaagaattttatgatgcagatgaagagactcagatgatcaagtga

Sequence Length

1608

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

20071161

NCBI GeneID

55356

Molecular Weight

26,794 Da

NCBI Official Full Name

Homo sapiens solute carrier family 22, member 15, mRNA

NCBI Official Synonym Full Names

solute carrier family 22 member 15

NCBI Official Symbol

SLC22A15

NCBI Official Synonym Symbols

FLIPT1; PRO34686

NCBI Protein Information

solute carrier family 22 member 15

UniProt Protein Name

Solute carrier family 22 member 15

Protein Family

Solute carrier family

UniProt Gene Name

SLC22A15

UniProt Synonym Gene Names

FLIPT1; Flipt 1

UniProt Entry Name

S22AF_HUMAN

NCBI Description

Organic ion transporters, such as SLC22A15, transport various medically and physiologically important compounds, including pharmaceuticals, toxins, hormones, neurotransmitters, and cellular metabolites. These transporters are also referred to as amphiphilic solute facilitators (ASFs).[supplied by OMIM, Apr 2004]

Uniprot Description

SLC22A15: Probably transports organic cations. Appears not to be the agmatine transporter. Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Transporter, SLC family; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p13.1

Cellular Component: integral to membrane

Molecular Function: substrate-specific transmembrane transporter activity

Research Articles on SLC22A15

1. Clinical trial of gene-disease association and gene-environment interaction. (HuGE Navigator)

Similar Products

Product Notes

The SLC22A15 slc22a15 (Catalog #AAA1275285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcatct accagatgta cttgtgcttc ctgctggccg tgctgctgca gctctacgtg gccacggagg ccatcctcat tgcactggtt ggggccacgc catcctacca ctgggacctg gcagagctcc tgccaaatca gagccacggt aaccagtcag ctggtgaaga ccaggccttt ggggactggc tcctgacagc caacggcagt gagatccata agcacgtgca tttcagcagc agcttcacct ccatcgcctc ggagtggttt ttaattgcca acagatccta caaagtcagt gcagcaagct cttttttctt cagtggtgta tttgttggag ttatctcttt tggtcagctt tcagatcgct tcggaaggaa aaaagtctat ctcacaggtt ttgctcttga catcttattt gcaattgcaa atggattttc cccctcatat gagttctttg cagtaactcg cttcctggtg ggcatgatga atggagggat gtcgctggtg gcctttgtct tgcttaatga gtgtgtgggc accgcctact gggcacttgc aggatcgatt ggcggcctct tctttgcagt tggcattgcc caatatgccc tgttaggata cttcatccgc tcctggagga ccctagccat tctggttaac ctgcagggaa cggtggtctt tctcttatct ttattcattc ctgaatcacc tcgttggtta tactcccagg gtcgactgag tgaggctgaa gaggcgctgt acctcattgc caagaggaac cgcaaactca agtgcacgtt ctcactaaca cacccagcca acaggagctg cagggagact ggaagtttcc tggatctctt tcgttaccgg gtcctgttag gacacacttt gatcctgatg ttcatctggt ttgtgtgcag cttggtgtat tatggcctaa ctctgagtgc gggtgatcta ggtggaagta tttatgccaa cctggccctg tctggcctca tagagattca atcttaccct ctctgtatct acttgattaa ccaaaaatgg tttggtcgga agcgaacatt atcagcattt ctgtgcctag gaggactggc ttgtcttatt gtaatgtttc ttccagaaaa gaaagacaca ggtgtgtttg cagtggtgaa cagccattcc ttgtccttgc tggggaagct gaccatcagt gctgccttta acattgttta tatctacacc tctgagcttt accctacagt catcaggaat gttgggcttg gaacttgttc catgttctcc cgagttggtg ggattattgc tcccttcatc ccctcactga aatatgtgca atggtcttta ccattcattg tcttcggagc cacgggtctg acctccggcc tcctgagttt gttattgccg gagaccctta acagtccgct gctagaaaca ttctccgacc ttcaggtgta ttcgtatcgc aggctgggag aagaagcatt atctttacag gctttggacc cccaacagtg tgtggacaag gagagctctt tagggagtga gagtgaggaa gaggaagaat tttatgatgc agatgaagag actcagatga tcaagtga. It is sometimes possible for the material contained within the vial of "SLC22A15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SLC22A15 cdna clone