SLC18A1 cdna clone
SLC18A1 cDNA Clone
Gene Names
SLC18A1; CGAT; VAT1; VMAT1
Synonyms
SLC18A1; SLC18A1 cDNA Clone; SLC18A1 cdna clone
Sequence
atgctccggcccattctggatgctccccagcggttgctgaaggaggggagagcgtcccggcagctggtgctggtggtggtattcgtcgctttgctcctggacaacatgctgtttactgtggtggtgccaattgtgcccaccttcctatatgacatggagttcaaagaagtcaactcttctctgcacctcggccatgccggaagttccccacatgccctcgcctctcctgccttttccaccatcttctccttcttcaacaacaacaccgtggctgttgaagaaagcgtacctagtggaatagcatggatgaatgacactgccagcaccatcccacctccagccactgaagccatctcagctcataaaaacaactgcttgcaaggcacaggtttcttggaggaagagactacccgggtcggggttctgtttgcttcaaaggctgtgatgcaacttctggtcaacccattcgtgggccctctcaccaacaggattggatatcatatccccatgtttgctggctttgttatcatgtttctctccacagttatgtttgctttttctgggacctatactctactctttgtggcccgaacccttcaaggcattggatcttcattttcatctgttgcaggtcttggaatgctggccagtgtctacactgatgaccatgagagaggacgagccatgggaactgctctggggggcctggccttggggttgctggtgggagctccctttggaagtgtaatgtacgagtttgttgggaagtctgcacccttcctcatcctggccttcctggcactactggatggagcactccagctttgcatcctacagccttccaaagtctctcctgagagtgccaaggggactcccctctttatgcttctcaaagacccttacatcctggtggctgcaggtctagctttcttgcctgccagtgtgtcctacctcattggcaccaacctctttggtgtgttggccaacaagatgggtcggtggctgtgttccctaatcgggatgctggtagtaggtaccagcttgctctgtgttcctctggctcacaatatttttggtctcattggccccaatgcagggcttggccttgccataggcatggtggattcttctatgatgcccatcatggggcacctggtggatctacgccacacctcggtgtatgggagtgtctacgccatcgctgatgtggctttttgcatgggctttgctataggtccatccaccggtggtgccattgtaaaggccatcggttttccctggctcatggtcatcactggggtcatcaacatcgtctatgctccactctgctactacctgcggagccccccggcaaaggaagagaagcttgctattctgagtcaggactgccccatggagacccggatgtatgcaacccagaagcccacgaaggaatttcctctgggggaggacagtgatgaggagcctgaccatgaggagtag
Sequence Length
1482
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,677 Da
NCBI Official Full Name
Homo sapiens solute carrier family 18 (vesicular monoamine), member 1, mRNA
NCBI Official Synonym Full Names
solute carrier family 18 member A1
NCBI Official Symbol
SLC18A1
NCBI Official Synonym Symbols
CGAT; VAT1; VMAT1
NCBI Protein Information
chromaffin granule amine transporter
UniProt Protein Name
Chromaffin granule amine transporter
Protein Family
UniProt Gene Name
SLC18A1
UniProt Synonym Gene Names
VAT1; VMAT1; VAT1
UniProt Entry Name
VMAT1_HUMAN
NCBI Description
The vesicular monoamine transporter acts to accumulate cytosolic monoamines into vesicles, using the proton gradient maintained across the vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (Peter et al., 1993 [PubMed 7905859]). See also SLC18A2 (MIM 193001).[supplied by OMIM, Mar 2008]
Uniprot Description
SLC18A1: Involved in the vesicular transport of biogenic amines. Belongs to the major facilitator superfamily. Vesicular transporter family.
Protein type: Transporter, SLC family; Membrane protein, multi-pass; Transporter; Membrane protein, integral
Chromosomal Location of Human Ortholog: 8p21.3
Cellular Component: integral to plasma membrane; synaptic vesicle membrane; terminal button
Molecular Function: monoamine transmembrane transporter activity; serotonin transmembrane transporter activity
Biological Process: monoamine transport; synaptic transmission; synaptic vesicle amine transport
Research Articles on SLC18A1
Similar Products
Product Notes
The SLC18A1 slc18a1 (Catalog #AAA1267243) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctccggc ccattctgga tgctccccag cggttgctga aggaggggag agcgtcccgg cagctggtgc tggtggtggt attcgtcgct ttgctcctgg acaacatgct gtttactgtg gtggtgccaa ttgtgcccac cttcctatat gacatggagt tcaaagaagt caactcttct ctgcacctcg gccatgccgg aagttcccca catgccctcg cctctcctgc cttttccacc atcttctcct tcttcaacaa caacaccgtg gctgttgaag aaagcgtacc tagtggaata gcatggatga atgacactgc cagcaccatc ccacctccag ccactgaagc catctcagct cataaaaaca actgcttgca aggcacaggt ttcttggagg aagagactac ccgggtcggg gttctgtttg cttcaaaggc tgtgatgcaa cttctggtca acccattcgt gggccctctc accaacagga ttggatatca tatccccatg tttgctggct ttgttatcat gtttctctcc acagttatgt ttgctttttc tgggacctat actctactct ttgtggcccg aacccttcaa ggcattggat cttcattttc atctgttgca ggtcttggaa tgctggccag tgtctacact gatgaccatg agagaggacg agccatggga actgctctgg ggggcctggc cttggggttg ctggtgggag ctccctttgg aagtgtaatg tacgagtttg ttgggaagtc tgcacccttc ctcatcctgg ccttcctggc actactggat ggagcactcc agctttgcat cctacagcct tccaaagtct ctcctgagag tgccaagggg actcccctct ttatgcttct caaagaccct tacatcctgg tggctgcagg tctagctttc ttgcctgcca gtgtgtccta cctcattggc accaacctct ttggtgtgtt ggccaacaag atgggtcggt ggctgtgttc cctaatcggg atgctggtag taggtaccag cttgctctgt gttcctctgg ctcacaatat ttttggtctc attggcccca atgcagggct tggccttgcc ataggcatgg tggattcttc tatgatgccc atcatggggc acctggtgga tctacgccac acctcggtgt atgggagtgt ctacgccatc gctgatgtgg ctttttgcat gggctttgct ataggtccat ccaccggtgg tgccattgta aaggccatcg gttttccctg gctcatggtc atcactgggg tcatcaacat cgtctatgct ccactctgct actacctgcg gagccccccg gcaaaggaag agaagcttgc tattctgagt caggactgcc ccatggagac ccggatgtat gcaacccaga agcccacgaa ggaatttcct ctgggggagg acagtgatga ggagcctgac catgaggagt ag. It is sometimes possible for the material contained within the vial of "SLC18A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
