SLC12A9 cdna clone

SLC12A9 cDNA Clone

Gene Names

SLC12A9; CCC6; CIP1; WO3.3; hCCC6

Synonyms

SLC12A9; SLC12A9 cDNA Clone; SLC12A9 cdna clone

Ordering
Cat. Num. AAA1273751 For Research Use Only!

Sequence

atggccagcgagagctcacctctgctggcctaccggctcctgggggaggagggggttgccctccctgccaatggggccgggggtcctggaggggcgtctgcccggaagctgtccaccttcctgggtgtggtggtgcccactgtcctgtccatgttcagcatagttgtttttctgaggattgatgccacagggcccagtgggctccgggtcctgccccagggctacggctggaacctgctgtatggctccctgctgctgggccttgtgggtggggtctgcaccctgggagccggcctctatgcccgggcctcattcctcacattcctgctggtctctggctccctggcctctgtgctcatcagttttgtggctgtggggccgagggacatccgcttgactcctaggcctggccccaatggctcctccctgccgccccggtttggccacttcaccggcttcaacagcagtaccctgaaggacaacttgggcgctggctatgctgaggactacaccacgggagccgtgatgaattttgccagcgtctttgctgtcctctttaacggctgtacaggcatcatggctggggccaacatgtcaggggagctgaaggaccccagccgggcgatccctctgggcacgatcgtcgccgtcgcctacaccttcttcgtctatgtcctgcttttctttctctccagcttcacttgtgacaggaccctgctgcaggaagactatgggttcttccgcgccatcagcctgtggcccccactggtgttgatcggaatctatgccacagcgctctcagcgtccatgagctcgctcattggtgcctcccgcatcctccatgccctggcccgggatgacctctttggcgtgatcttggcaccggccaaggttgtgtcccgagggggaaacccctgggcagctgtactttattcttggggcctggtgcagctggtgctcctggctgggaagctgaacacactggccgctgtggtcactgtcttctacctggtggcctatgctgccgtggacctgtcctgcctgagcctggagtgggcctcggcccccaacttccgccccaccttcagcctgttctcctggcacacctgcctgctgggggtggcctcctgcctgctcatgatgttcctcatcagtcctggcgcggctggtggctccctgctcctcatgggtctgctggctgccctgctcaccgcgcgaggaggccccagtagctggggctatgtcagccaggccttgcttttccaccaggtgcgtaagtatctgcttcggctggacgtccggaaggatcacgtgaagttctggcggccccagctgctgctcctggtggggaacccccggggcgccctgcctctgctgcggttggccaaccagcttaagaagggggggctgtatgtgctgggccacgtcaccctgggagacctcgactccctgccctcggaccctgtacagccgcagtatggggcatggctcagcctggtggaccgtgcccaggtgaaggcttttgtggatctaaccctctcaccctccgtgcgccagggggctcagcatctgctgcgaatctccggcctcgagtcaaactcgcatcccctgccgtga

Sequence Length

1617

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

13111796

NCBI GeneID

56996

Molecular Weight

66,429 Da

NCBI Official Full Name

Homo sapiens solute carrier family 12 (potassium/chloride transporters), member 9, mRNA

NCBI Official Synonym Full Names

solute carrier family 12 member 9

NCBI Official Symbol

SLC12A9

NCBI Official Synonym Symbols

CCC6; CIP1; WO3.3; hCCC6

NCBI Protein Information

solute carrier family 12 member 9

UniProt Protein Name

Solute carrier family 12 member 9

Protein Family

Solute carrier family

UniProt Gene Name

SLC12A9

UniProt Synonym Gene Names

CCC6; CIP1; hCCC6; CCC-interacting protein 1; hCIP1

UniProt Entry Name

S12A9_HUMAN

Uniprot Description

SLC12A9: May be an inhibitor of SLC12A1. Seems to correspond to a subunit of a multimeric transport system and thus, additional subunits may be required for its function. Belongs to the SLC12A transporter family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, SLC family; Transporter; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 7q22

Molecular Function: cation:chloride symporter activity; potassium ion symporter activity; potassium:chloride symporter activity

Research Articles on SLC12A9

1. Review summarizes three human disorders that have been linked to the mutation/dysfunction of Na-Cl, Na-K-2Cl, and K-Cl cotransporters (Bartter's, Gitleman's, and Andermann's syndromes).

Similar Products

Product Notes

The SLC12A9 slc12a9 (Catalog #AAA1273751) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagcg agagctcacc tctgctggcc taccggctcc tgggggagga gggggttgcc ctccctgcca atggggccgg gggtcctgga ggggcgtctg cccggaagct gtccaccttc ctgggtgtgg tggtgcccac tgtcctgtcc atgttcagca tagttgtttt tctgaggatt gatgccacag ggcccagtgg gctccgggtc ctgccccagg gctacggctg gaacctgctg tatggctccc tgctgctggg ccttgtgggt ggggtctgca ccctgggagc cggcctctat gcccgggcct cattcctcac attcctgctg gtctctggct ccctggcctc tgtgctcatc agttttgtgg ctgtggggcc gagggacatc cgcttgactc ctaggcctgg ccccaatggc tcctccctgc cgccccggtt tggccacttc accggcttca acagcagtac cctgaaggac aacttgggcg ctggctatgc tgaggactac accacgggag ccgtgatgaa ttttgccagc gtctttgctg tcctctttaa cggctgtaca ggcatcatgg ctggggccaa catgtcaggg gagctgaagg accccagccg ggcgatccct ctgggcacga tcgtcgccgt cgcctacacc ttcttcgtct atgtcctgct tttctttctc tccagcttca cttgtgacag gaccctgctg caggaagact atgggttctt ccgcgccatc agcctgtggc ccccactggt gttgatcgga atctatgcca cagcgctctc agcgtccatg agctcgctca ttggtgcctc ccgcatcctc catgccctgg cccgggatga cctctttggc gtgatcttgg caccggccaa ggttgtgtcc cgagggggaa acccctgggc agctgtactt tattcttggg gcctggtgca gctggtgctc ctggctggga agctgaacac actggccgct gtggtcactg tcttctacct ggtggcctat gctgccgtgg acctgtcctg cctgagcctg gagtgggcct cggcccccaa cttccgcccc accttcagcc tgttctcctg gcacacctgc ctgctggggg tggcctcctg cctgctcatg atgttcctca tcagtcctgg cgcggctggt ggctccctgc tcctcatggg tctgctggct gccctgctca ccgcgcgagg aggccccagt agctggggct atgtcagcca ggccttgctt ttccaccagg tgcgtaagta tctgcttcgg ctggacgtcc ggaaggatca cgtgaagttc tggcggcccc agctgctgct cctggtgggg aacccccggg gcgccctgcc tctgctgcgg ttggccaacc agcttaagaa gggggggctg tatgtgctgg gccacgtcac cctgggagac ctcgactccc tgccctcgga ccctgtacag ccgcagtatg gggcatggct cagcctggtg gaccgtgccc aggtgaaggc ttttgtggat ctaaccctct caccctccgt gcgccagggg gctcagcatc tgctgcgaat ctccggcctc gagtcaaact cgcatcccct gccgtga. It is sometimes possible for the material contained within the vial of "SLC12A9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SLC12A9 cdna clone