Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC11A1 cdna clone

SLC11A1 cDNA Clone

Gene Names
SLC11A1; LSH; NRAMP; NRAMP1
Synonyms
SLC11A1; SLC11A1 cDNA Clone; SLC11A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgcgatgtcagctcactgcaacctctacctcccaggtgccccgcaccgtcctctggctgaccatcgagctagccattgtgggctccgacatgcaggaagtcatcggcacggccattgcattcaatctgctctcagctggacgaatcccactctggggtggcgtcctcatcaccatcgtggacaccttcttcttcctcttcctcgataactacgggctgcggaagctggaagctttttttggactccttataaccattatggccttgacctttggctatgagtatgtggtggcgcgtcctgagcagggagcgcttcttcggggcctgttcctgccctcgtgcccgggctgcggccaccccgagctgctgcaggcggtgggcattgttggcgccatcatcatgccccacaacatctacctgcactcggccctggtcaagtctcgagagatagaccgggcccgccgagcggacatcagagaagccaacatgtacttcctgattgaggccaccatcgccctgtccgtctcctttatcatcaacctctttgtcatggctgtctttgggcaggccttctaccagaaaaccaaccaggctgcgttcaacatctgtgccaacagcagcctccacgactacgccaagatcttccccatgaacaacgccaccgtggccgtggacatttaccaggggggcgtgatcctgggctgcctgttcggccccgcggccctctacatctgggccataggtctcctggcggctgggcagagctccaccatgacgggcacctacgcgggacagttcgtgatggagggcttcctgaggctgcggtggtcacgcttcgcccgtgtcctcctcacccgctcctgcgccatcctgcccaccgtgctcgtggctgtcttccgggacctgagggacttgtcgggcctcaatgatctgctcaacgtgctgcagagcctgctgctcccgttcgccgtgctgcccatcctcacgttcaccagcatgcccaccctcatgcaggagtttgccaatggcctgctgaacaaggtcgtcacctcttccatcatggtgctagtctgcgccatcaacctctacttcgtggtcagctatctgcccagcctgccccaccctgcctacttcggccttgcagccttgctggccgcagcctacctgggcctcagcacctacctggtctggacctgttgccttgcccacggagccacctttctggcccacagctcccaccaccacttcctgtatgggctccttgaagaggaccagaaaggggagacctctggctag
Sequence Length
1299
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,292 Da
NCBI Official Full Name
Homo sapiens solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1, mRNA
NCBI Official Synonym Full Names
solute carrier family 11 member 1
NCBI Official Symbol
SLC11A1
NCBI Official Synonym Symbols
LSH; NRAMP; NRAMP1
NCBI Protein Information
natural resistance-associated macrophage protein 1
UniProt Protein Name
Natural resistance-associated macrophage protein 1
UniProt Gene Name
SLC11A1
UniProt Synonym Gene Names
LSH; NRAMP; NRAMP1; NRAMP 1
UniProt Entry Name
NRAM1_HUMAN

NCBI Description

This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

SLC11A1: Divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Macrophage-specific membrane transport function. Controls natural resistance to infection with intracellular parasites. Pathogen resistance involves sequestration of Fe(2+) and Mn(2+), cofactors of both prokaryotic and eukaryotic catalases and superoxide dismutases, not only to protect the macrophage against its own generation of reactive oxygen species, but to deny the cations to the pathogen for synthesis of its protective enzymes. Belongs to the NRAMP family.

Protein type: Membrane protein, multi-pass; Transporter; Transporter, SLC family; Vesicle; Cell surface; Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: late endosome; late endosome membrane; lysosome; phagocytic vesicle membrane; plasma membrane

Molecular Function: manganese ion transmembrane transporter activity; metal ion:hydrogen antiporter activity; protein homodimerization activity; transition metal ion transmembrane transporter activity

Biological Process: activation of protein kinase activity; antigen processing and presentation of peptide antigen; cell redox homeostasis; cellular cadmium ion homeostasis; cellular iron ion homeostasis; defense response to bacterium; defense response to Gram-negative bacterium; defense response to protozoan; inflammatory response; interleukin-2 production; interleukin-3 production; iron ion homeostasis; iron ion transport; L-arginine import; macrophage activation; manganese ion transport; MHC class II biosynthetic process; mRNA stabilization; negative regulation of cytokine production; nitrite transport; phagocytosis; positive regulation of cytokine production; positive regulation of dendritic cell antigen processing and presentation; positive regulation of interferon-gamma production; positive regulation of phagocytosis; positive regulation of T-helper 1 type immune response; positive regulation of transcription from RNA polymerase II promoter; respiratory burst; response to bacterium; response to lipopolysaccharide; T cell cytokine production; T cell proliferation during immune response; vacuolar acidification; wound healing

Disease: Buruli Ulcer, Susceptibility To; Mycobacterium Tuberculosis, Susceptibility To

Research Articles on SLC11A1

Similar Products

Product Notes

The SLC11A1 slc11a1 (Catalog #AAA1275327) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcgat gtcagctcac tgcaacctct acctcccagg tgccccgcac cgtcctctgg ctgaccatcg agctagccat tgtgggctcc gacatgcagg aagtcatcgg cacggccatt gcattcaatc tgctctcagc tggacgaatc ccactctggg gtggcgtcct catcaccatc gtggacacct tcttcttcct cttcctcgat aactacgggc tgcggaagct ggaagctttt tttggactcc ttataaccat tatggccttg acctttggct atgagtatgt ggtggcgcgt cctgagcagg gagcgcttct tcggggcctg ttcctgccct cgtgcccggg ctgcggccac cccgagctgc tgcaggcggt gggcattgtt ggcgccatca tcatgcccca caacatctac ctgcactcgg ccctggtcaa gtctcgagag atagaccggg cccgccgagc ggacatcaga gaagccaaca tgtacttcct gattgaggcc accatcgccc tgtccgtctc ctttatcatc aacctctttg tcatggctgt ctttgggcag gccttctacc agaaaaccaa ccaggctgcg ttcaacatct gtgccaacag cagcctccac gactacgcca agatcttccc catgaacaac gccaccgtgg ccgtggacat ttaccagggg ggcgtgatcc tgggctgcct gttcggcccc gcggccctct acatctgggc cataggtctc ctggcggctg ggcagagctc caccatgacg ggcacctacg cgggacagtt cgtgatggag ggcttcctga ggctgcggtg gtcacgcttc gcccgtgtcc tcctcacccg ctcctgcgcc atcctgccca ccgtgctcgt ggctgtcttc cgggacctga gggacttgtc gggcctcaat gatctgctca acgtgctgca gagcctgctg ctcccgttcg ccgtgctgcc catcctcacg ttcaccagca tgcccaccct catgcaggag tttgccaatg gcctgctgaa caaggtcgtc acctcttcca tcatggtgct agtctgcgcc atcaacctct acttcgtggt cagctatctg cccagcctgc cccaccctgc ctacttcggc cttgcagcct tgctggccgc agcctacctg ggcctcagca cctacctggt ctggacctgt tgccttgccc acggagccac ctttctggcc cacagctccc accaccactt cctgtatggg ctccttgaag aggaccagaa aggggagacc tctggctag. It is sometimes possible for the material contained within the vial of "SLC11A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.