Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SKP2 cdna clone

SKP2 cDNA Clone

Gene Names
SKP2; p45; FBL1; FLB1; FBXL1
Synonyms
SKP2; SKP2 cDNA Clone; SKP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacaggaagcacctccaggagattccagacctgagtagcaacgttgccaccagcttcacgtggggatgggattccagcaagacttctgaactgctgtcaggcatgggggtctccgccctggagaaagaggagcccgacagtgagaacatcccccaggaactgctctcaaacctgggccacccggagagccccccacggaaacggctgaagagcaaagggagtgacaaagactttgtgattgtccgcaggcctaagctaaatcgagagaactttccaggtgtttcatgggactcccttccggatgagctgctcttgggaatcttttcctgtctgtgcctccctgagctgctaaaggtctctggtgtttgtaagaggtggtatcgcctagcgtctgatgagtctctatggcagaccttagacctcacaggtaaaaatctgcacccggatgtgactggtcggttgctgtctcaaggggtgattgccttccgctgcccacgatcatttatggaccaaccattggctgaacatttcagcccttttcgtgtacagcacatggacctatcgaactcagttatagaagtgtccaccctccacggcatactgtctcagtgttccaagttgcagaatctaagcctggaaggcctgcggctttcggatcccattgtcaatactctcgcaaaaaactcaaatttagtgcgacttaacctttctgggtgttctggattctctgaatttgccctgcagactttgctaagcagctgttccagactggatgagctgaacctctcctggtgttttgatttcactgaaaagcatgtacaggtggctgttgcgcatgtgtcagagaccatcacccagctgaatcttagcggctacagaaagaatctccagaaatcagatctctctactttagttagaagatgccccaatcttgtccatctagacttaagtgatagtgtcatgctaaagaatgactgctttcaggaatttttccagctcaactacctccaacacctatcactcagtcggtgctatgatataatacctgaaactttactattagtgacaagagctggggttaggatccggttggactctgacatcggatgccctcaaacatacagaacttccaaactcaagtccagccataagctattttgccaacatgtcagagtaatctgtatttttgtatgtgatttctacttttatagacttgttttaaaacaataa
Sequence Length
1233
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,763 Da
NCBI Official Full Name
Homo sapiens S-phase kinase-associated protein 2 (p45), mRNA
NCBI Official Synonym Full Names
S-phase kinase-associated protein 2, E3 ubiquitin protein ligase
NCBI Official Symbol
SKP2
NCBI Official Synonym Symbols
p45; FBL1; FLB1; FBXL1
NCBI Protein Information
S-phase kinase-associated protein 2
UniProt Protein Name
S-phase kinase-associated protein 2
UniProt Gene Name
SKP2
UniProt Synonym Gene Names
FBXL1
UniProt Entry Name
SKP2_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]

Uniprot Description

SKP2: an F-box protein of the SCF (SKP1-CUL1-F- box protein) E3 ubiquitin ligase system. The F-box component of the SCF complex is responsible for recognizing different substrates for ubiquitination. The SCF E3 complex mediates the ubiquitination and subsequent proteasomal degradation of target proteins involved in cell cycle progression, signal transduction and transcription. Specifically recognizes phosphorylated CDKN1B/p27kip and is involved in regulation of G1/S transition. Degradation of CDKN1B/p27kip also requires CKS1. Three alternatively-spliced isoforms have been described.

Protein type: Cell cycle regulation; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 5p13

Cellular Component: cytoplasm; cytosol; nucleolus; nucleoplasm; nucleus; SCF ubiquitin ligase complex

Molecular Function: identical protein binding; protein binding; ubiquitin-protein ligase activity

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; cell proliferation; protein polyubiquitination; regulation of apoptosis

Research Articles on SKP2

Similar Products

Product Notes

The SKP2 skp2 (Catalog #AAA1277881) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacagga agcacctcca ggagattcca gacctgagta gcaacgttgc caccagcttc acgtggggat gggattccag caagacttct gaactgctgt caggcatggg ggtctccgcc ctggagaaag aggagcccga cagtgagaac atcccccagg aactgctctc aaacctgggc cacccggaga gccccccacg gaaacggctg aagagcaaag ggagtgacaa agactttgtg attgtccgca ggcctaagct aaatcgagag aactttccag gtgtttcatg ggactccctt ccggatgagc tgctcttggg aatcttttcc tgtctgtgcc tccctgagct gctaaaggtc tctggtgttt gtaagaggtg gtatcgccta gcgtctgatg agtctctatg gcagacctta gacctcacag gtaaaaatct gcacccggat gtgactggtc ggttgctgtc tcaaggggtg attgccttcc gctgcccacg atcatttatg gaccaaccat tggctgaaca tttcagccct tttcgtgtac agcacatgga cctatcgaac tcagttatag aagtgtccac cctccacggc atactgtctc agtgttccaa gttgcagaat ctaagcctgg aaggcctgcg gctttcggat cccattgtca atactctcgc aaaaaactca aatttagtgc gacttaacct ttctgggtgt tctggattct ctgaatttgc cctgcagact ttgctaagca gctgttccag actggatgag ctgaacctct cctggtgttt tgatttcact gaaaagcatg tacaggtggc tgttgcgcat gtgtcagaga ccatcaccca gctgaatctt agcggctaca gaaagaatct ccagaaatca gatctctcta ctttagttag aagatgcccc aatcttgtcc atctagactt aagtgatagt gtcatgctaa agaatgactg ctttcaggaa tttttccagc tcaactacct ccaacaccta tcactcagtc ggtgctatga tataatacct gaaactttac tattagtgac aagagctggg gttaggatcc ggttggactc tgacatcgga tgccctcaaa catacagaac ttccaaactc aagtccagcc ataagctatt ttgccaacat gtcagagtaa tctgtatttt tgtatgtgat ttctactttt atagacttgt tttaaaacaa taa. It is sometimes possible for the material contained within the vial of "SKP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.