Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SKIL cdna clone

SKIL cDNA Clone

Gene Names
SKIL; SNO; SnoA; SnoI; SnoN
Synonyms
SKIL; SKIL cDNA Clone; SKIL cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaacctccagacaaatttctccttggttcagggctcaactaaaaaactgaatgggatgggagatgatggcagccccccagcgaaaaaaatgataacggacattcatgtaaatggaaaaacgataaacaaggtgccaacagttaagaaggaacacttggatgactatggagaagcaccagtggaaactgatggagagcatgttaagcgaacctgtacttctgttcctgaaactttgcatttaaatcccagtttgaaacacacattggcacaattccatttaagtagtcagagctcgctgggtggaccagcagcattttctgctcggcattcccaagaaagcatgtcgcctactgtatttctgcctcttccatcacctcaggttcttcctggcccattgctcatcccttcagatagctccacagaactcactcagactgtgttggaaggggaatctatttcttgttttcaagttggaggagaaaagagactctgtttgccccaagtcttaaattctgttctccgagaatttacactccagcaaataaatacagtgtgtgatgaactgtacatatattgttcaaggtgtacttcagaccagcttcatatcttaaaggtactgggcatacttccattcaatgccccatcctgtgggctgattacattaactgatgcacaaagattatgtaatgctttattgcggccacgaacttttcctcaaaatggtagcgtacttcctgctaaaagctcattggcccagttaaaggaaactggcagtgcctttgaagttgagcatgaatgcctaggcaaatgtcagggtttatttgcaccccagttttatgttcagcctgatgctccgtgtattcaatgtctggagtgttgtggaatgtttgcaccccagacgtttgtgatgcattctcacagatcacctgacaaaagaacttgccactggggctttgaatcagctaaatggcattgctatcttcatgtgaaccaaaaatacttaggaacacctgaagaaaagaaactgaagataattttagaagaaatgaaggagaagtttagcatgagaagtggaaagagaaatcaatccaagacagatgcaccatcaggaatggaattacagtcatggtatcctgttataaagcaggaaggtgaccatgtttctcagacacattcatttttacaccccagctactacttatacatgtgtgataaagtggttgccccaaatgtgtcacttacttctgctgtatcccagtctaaagagctcacaaagacagaggcaagtaagtccatatcaagacagtcagagaaggctcacagtagtggtaaacttcaaaaaacagtgtcttatccagatgtctcacttgaggaacaggagaaaatggatttaaaaacaagtagagaattatgtagccgtttagatgcatcaatctcaaataattctacaagtaaaaggaaatctgagtctgccacttgcaacttagtcagagacataaacaaagtgggaattggccttgttgctgccgcttcatctccgcttcttgtgaaagatgtcatttgtgaggatgataagggaaaaatcatggaagaagtaatgagaacttatttaaaacaacaggaaaaactaaacttgattttgcaaaagaagcaacaacttcagatggaagtaaaaatgttgagtagttcaaaatctatgaaggaactcactgaagaacagcagaatttacagaaagagcttgaatctttgcagaatgaacatgctcaaagaatggaagaattttatgttgaacagaaagacttagagaaaaaattggagcagataatgaagcaaaaatgtacctgtgactcaaatttagaaaaagacaaagaggctgaatatgcaggacagttggcagaactgaggcagagattggaccatgctgaggccgataggcaagaactccaagatgaactcagacaggaacgggaagcaagacagaagttagagatgatgataaaagagctaaagctgcaaattctgaaatcatcaaagactgctaaagaatag
Sequence Length
2055
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,784 Da
NCBI Official Full Name
Homo sapiens SKI-like oncogene, mRNA
NCBI Official Synonym Full Names
SKI like proto-oncogene
NCBI Official Symbol
SKIL
NCBI Official Synonym Symbols
SNO; SnoA; SnoI; SnoN
NCBI Protein Information
ski-like protein
UniProt Protein Name
Ski-like protein
Protein Family
UniProt Gene Name
SKIL
UniProt Synonym Gene Names
SNO
UniProt Entry Name
SKIL_HUMAN

NCBI Description

The protein encoded by this gene is a component of the SMAD pathway, which regulates cell growth and differentiation through transforming growth factor-beta (TGFB). In the absence of ligand, the encoded protein binds to the promoter region of TGFB-responsive genes and recruits a nuclear repressor complex. TGFB signaling causes SMAD3 to enter the nucleus and degrade this protein, allowing these genes to be activated. Four transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

SKIL: May have regulatory role in cell division or differentiation in response to extracellular signals. Interacts with SMAD2, SMAD3 and RNF111. Isoform 1 interacts with WWP1. Isoform SNON and isoform SNOA are widely expressed. Highest expression is found in skeletal muscle, followed by placenta and lung. Lowest expression in heart, brain and pancreas. Isoform SNOI expression is restricted to skeletal muscle. Belongs to the SKI family. 5 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 3q26

Cellular Component: nucleoplasm; protein complex

Molecular Function: protein binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; regulation of apoptosis

Research Articles on SKIL

Similar Products

Product Notes

The SKIL skil (Catalog #AAA1275104) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaacc tccagacaaa tttctccttg gttcagggct caactaaaaa actgaatggg atgggagatg atggcagccc cccagcgaaa aaaatgataa cggacattca tgtaaatgga aaaacgataa acaaggtgcc aacagttaag aaggaacact tggatgacta tggagaagca ccagtggaaa ctgatggaga gcatgttaag cgaacctgta cttctgttcc tgaaactttg catttaaatc ccagtttgaa acacacattg gcacaattcc atttaagtag tcagagctcg ctgggtggac cagcagcatt ttctgctcgg cattcccaag aaagcatgtc gcctactgta tttctgcctc ttccatcacc tcaggttctt cctggcccat tgctcatccc ttcagatagc tccacagaac tcactcagac tgtgttggaa ggggaatcta tttcttgttt tcaagttgga ggagaaaaga gactctgttt gccccaagtc ttaaattctg ttctccgaga atttacactc cagcaaataa atacagtgtg tgatgaactg tacatatatt gttcaaggtg tacttcagac cagcttcata tcttaaaggt actgggcata cttccattca atgccccatc ctgtgggctg attacattaa ctgatgcaca aagattatgt aatgctttat tgcggccacg aacttttcct caaaatggta gcgtacttcc tgctaaaagc tcattggccc agttaaagga aactggcagt gcctttgaag ttgagcatga atgcctaggc aaatgtcagg gtttatttgc accccagttt tatgttcagc ctgatgctcc gtgtattcaa tgtctggagt gttgtggaat gtttgcaccc cagacgtttg tgatgcattc tcacagatca cctgacaaaa gaacttgcca ctggggcttt gaatcagcta aatggcattg ctatcttcat gtgaaccaaa aatacttagg aacacctgaa gaaaagaaac tgaagataat tttagaagaa atgaaggaga agtttagcat gagaagtgga aagagaaatc aatccaagac agatgcacca tcaggaatgg aattacagtc atggtatcct gttataaagc aggaaggtga ccatgtttct cagacacatt catttttaca ccccagctac tacttataca tgtgtgataa agtggttgcc ccaaatgtgt cacttacttc tgctgtatcc cagtctaaag agctcacaaa gacagaggca agtaagtcca tatcaagaca gtcagagaag gctcacagta gtggtaaact tcaaaaaaca gtgtcttatc cagatgtctc acttgaggaa caggagaaaa tggatttaaa aacaagtaga gaattatgta gccgtttaga tgcatcaatc tcaaataatt ctacaagtaa aaggaaatct gagtctgcca cttgcaactt agtcagagac ataaacaaag tgggaattgg ccttgttgct gccgcttcat ctccgcttct tgtgaaagat gtcatttgtg aggatgataa gggaaaaatc atggaagaag taatgagaac ttatttaaaa caacaggaaa aactaaactt gattttgcaa aagaagcaac aacttcagat ggaagtaaaa atgttgagta gttcaaaatc tatgaaggaa ctcactgaag aacagcagaa tttacagaaa gagcttgaat ctttgcagaa tgaacatgct caaagaatgg aagaatttta tgttgaacag aaagacttag agaaaaaatt ggagcagata atgaagcaaa aatgtacctg tgactcaaat ttagaaaaag acaaagaggc tgaatatgca ggacagttgg cagaactgag gcagagattg gaccatgctg aggccgatag gcaagaactc caagatgaac tcagacagga acgggaagca agacagaagt tagagatgat gataaaagag ctaaagctgc aaattctgaa atcatcaaag actgctaaag aatag. It is sometimes possible for the material contained within the vial of "SKIL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.