Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SKAP2 cdna clone

SKAP2 cDNA Clone

Gene Names
SKAP2; PRAP; RA70; SAPS; SCAP2; SKAP55R; SKAP-HOM
Synonyms
SKAP2; SKAP2 cDNA Clone; SKAP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaaccccagcagcacctcctctccctaccccctccctgaggaaattaggaacctgttggcagatgttgaaacatttgtagcagatatactgaaaggagaaaatttatccaagaaagcaaaggaaaagagagaatcccttattaagaagataaaagatgtaaagtctatctatcttcaggaatttcaagacaaaggtgatgcagaagatggggaagaatatgatgacccttttgctgggcctccagacactatttcattagcctcagaacgatatgataaagacgatgaagccccctctgatggagcccagtttcctccaattgcagcacaagaccttccttttgttctaaaggctggctaccttgaaaaacgcagaaaagatcacagctttctgggatttgaatggcagaaacggtggtgtgctctcagtaaaacggtattctattattatggaagtgataaagacaaacaacagaaaggtgaatttgcaatagatggctacagtgtcagaatgaataacactctaagaaaggatggaaagaaagattgctgttttgaaatctctgctcctgataaacgtatatatcagtttacagcagcttctcccaaagatgctgaagaatgggtacagcagctgaaatttgtattgcaagatatggaatctgatattattcctgaggattatgatgagagaggagaattatatgatgatgttgatcatcctctaccaataagcaatccactaacaagcagtcaaccaatagatgatgaaatttatgaagaacttccagaagaagaagaggacagtgctccagtgaaagtggaagaacaaaggaagatgagtcaggatagtgtccatcacacctcaggggataagagcactgattatgctaatttttaccagggattgtgggattgtactggagctttttctgatgagttgtcatttaagcgtggtgatgtgatttacattcttagcaaggaatacaatagatatggctggtgggtaggagaaatgaagggagccattggcttggtgcctaaagcctacataatggagatgtatgatatttga
Sequence Length
1080
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,217 Da
NCBI Official Full Name
Homo sapiens src kinase associated phosphoprotein 2, mRNA
NCBI Official Synonym Full Names
src kinase associated phosphoprotein 2
NCBI Official Symbol
SKAP2
NCBI Official Synonym Symbols
PRAP; RA70; SAPS; SCAP2; SKAP55R; SKAP-HOM
NCBI Protein Information
src kinase-associated phosphoprotein 2
UniProt Protein Name
Src kinase-associated phosphoprotein 2
UniProt Gene Name
SKAP2
UniProt Synonym Gene Names
PRAP; RA70; SAPS; SCAP2; SKAP55R; SKAP-55HOM; SKAP-HOM
UniProt Entry Name
SKAP2_HUMAN

NCBI Description

The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]

Uniprot Description

SKAP2: an ubiquitous adapter protein thought to play a role in the src signaling pathway. Contains a coiled-coil domain, a pleckstrin homology domain, and a SH3 domain. The SH3 domain binds to the proline-rich domain of Pyk2, inhibiting alpha-synuclein tyrosine phosphorylation. Can be phosphorylated by Src family kinases but not by Pyk2. Functions as a downstream target for Pyk2 and plays a role in alpha-synuclein phosphorylation. Negatively regulates alpha-synuclein phosphorylation following cell stress.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 7p15.2

Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane

Molecular Function: protein binding; SH3/SH2 adaptor activity

Biological Process: immune response-activating signal transduction; protein complex assembly; signal transduction

Research Articles on SKAP2

Similar Products

Product Notes

The SKAP2 skap2 (Catalog #AAA1277852) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccaacc ccagcagcac ctcctctccc taccccctcc ctgaggaaat taggaacctg ttggcagatg ttgaaacatt tgtagcagat atactgaaag gagaaaattt atccaagaaa gcaaaggaaa agagagaatc ccttattaag aagataaaag atgtaaagtc tatctatctt caggaatttc aagacaaagg tgatgcagaa gatggggaag aatatgatga cccttttgct gggcctccag acactatttc attagcctca gaacgatatg ataaagacga tgaagccccc tctgatggag cccagtttcc tccaattgca gcacaagacc ttccttttgt tctaaaggct ggctaccttg aaaaacgcag aaaagatcac agctttctgg gatttgaatg gcagaaacgg tggtgtgctc tcagtaaaac ggtattctat tattatggaa gtgataaaga caaacaacag aaaggtgaat ttgcaataga tggctacagt gtcagaatga ataacactct aagaaaggat ggaaagaaag attgctgttt tgaaatctct gctcctgata aacgtatata tcagtttaca gcagcttctc ccaaagatgc tgaagaatgg gtacagcagc tgaaatttgt attgcaagat atggaatctg atattattcc tgaggattat gatgagagag gagaattata tgatgatgtt gatcatcctc taccaataag caatccacta acaagcagtc aaccaataga tgatgaaatt tatgaagaac ttccagaaga agaagaggac agtgctccag tgaaagtgga agaacaaagg aagatgagtc aggatagtgt ccatcacacc tcaggggata agagcactga ttatgctaat ttttaccagg gattgtggga ttgtactgga gctttttctg atgagttgtc atttaagcgt ggtgatgtga tttacattct tagcaaggaa tacaatagat atggctggtg ggtaggagaa atgaagggag ccattggctt ggtgcctaaa gcctacataa tggagatgta tgatatttga. It is sometimes possible for the material contained within the vial of "SKAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.