Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIX1 cdna clone

SIX1 cDNA Clone

Gene Names
SIX1; BOS3; TIP39; DFNA23
Synonyms
SIX1; SIX1 cDNA Clone; SIX1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgatgctgccgtcgtttggctttacgcaggagcaagtggcgtgcgtgtgcgaggttctgcagcaaggcggaaacctggagcgcctgggcaggttcctgtggtcactgcccgcctgcgaccacctgcacaagaacgagagcgtactcaaggccaaggcggtggtcgccttccaccgcggcaacttccgtgagctctacaagatcctggagagccaccagttctcgcctcacaaccaccccaaactgcagcaactgtggctgaaggcgcattacgtggaggccgagaagctgtgcggccgacccctgggcgccgtgggcaaatatcgggtgcgccgaaaatttccactgccgcgcaccatctgggacggcgaggagaccagctactgcttcaaggagaagtcgaggggtgtcctgcgggagtggtacgcgcacaatccctacccatcgccgcgtgagaagcgggagctggccgaggccaccggcctcaccaccacccaggtcagcaactggtttaagaaccggaggcaaagagaccgggccgcggaggccaaggaaagggagaacaccgaaaacaataactcctcctccaacaagcagaaccaactctctcctctggaagggggcaagccgctcatgtccagctcagaagaggaattctcacctccccaaagtccagaccagaactcggtccttctgctgcagggcaatatgggccacgccaggagctcaaactattctctcccgggcttaacagcctcgcagcccagtcacggcctgcagacccaccagcatcagctccaagactctctgctcggccccctcacctccagtctggtggacttggggtcctaa
Sequence Length
855
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,210 Da
NCBI Official Full Name
Homo sapiens SIX homeobox 1, mRNA
NCBI Official Synonym Full Names
SIX homeobox 1
NCBI Official Symbol
SIX1
NCBI Official Synonym Symbols
BOS3; TIP39; DFNA23
NCBI Protein Information
homeobox protein SIX1
UniProt Protein Name
Homeobox protein SIX1
Protein Family
UniProt Gene Name
SIX1
UniProt Entry Name
SIX1_HUMAN

NCBI Description

The protein encoded by this gene is a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 14 and is thought to be involved in limb development. Defects in this gene are a cause of autosomal dominant deafness type 23 (DFNA23) and branchiootic syndrome type 3 (BOS3). [provided by RefSeq, Jul 2008]

Uniprot Description

SIX1: May be involved in limb tendon and ligament development. Defects in SIX1 are the cause of deafness autosomal dominant type 23 (DFNA23). A form of non-syndromic deafness characterized by prelingual, bilateral, symmetric hearing loss with a conductive component present in some but not all patients. Defects in SIX1 are the cause of branchiootic syndrome type 3 (BOS3). BOS3 is a syndrome characterized by usually bilateral branchial cleft fistulas or cysts, sensorineural and/or conductive hearing loss, pre-auricular pits, and structural defects of the outer, middle or inner ear. Otic defects include malformed and hypoplastic pinnae, a narrowed external ear canal, bulbous internal auditory canal, stapes fixation, malformed and hypoplastic cochlea. Branchial and otic anomalies are as those seen in individuals with the branchiootorenal syndrome. However, renal anomalies are absent in branchiootic syndrome patients. Defects in SIX1 could be a cause of branchiootorenal syndrome (BOR). BOR is an autosomal dominant disorder manifested by various combinations of preauricular pits, branchial fistulae or cysts, lacrimal duct stenosis, hearing loss, structural defects of the outer, middle, or inner ear, and renal dysplasia. Associated defects include asthenic habitus, long narrow facies, constricted palate, deep overbite, and myopia. Hearing loss may be due to mondini type cochlear defect and stapes fixation. Penetrance of BOR syndrome is high, although expressivity can be extremely variable. Belongs to the SIX/Sine oculis homeobox family.

Protein type: DNA-binding; Transcription factor; Cell development/differentiation

Chromosomal Location of Human Ortholog: 14q23.1

Cellular Component: nucleolus; nucleus; transcription factor complex

Molecular Function: DNA binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: embryonic cranial skeleton morphogenesis; embryonic skeletal morphogenesis; epithelial cell differentiation; generation of neurons; induction of an organ; inner ear development; inner ear morphogenesis; kidney development; myoblast migration; negative regulation of neuron apoptosis; pattern specification process; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of neuron differentiation; regulation of transcription, DNA-dependent; skeletal muscle development; thymus development; thyroid gland development; ureteric bud branching; ureteric bud development

Disease: Branchiootic Syndrome 3; Branchiootorenal Syndrome 1; Deafness, Autosomal Dominant 23

Research Articles on SIX1

Similar Products

Product Notes

The SIX1 six1 (Catalog #AAA1266468) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgatgc tgccgtcgtt tggctttacg caggagcaag tggcgtgcgt gtgcgaggtt ctgcagcaag gcggaaacct ggagcgcctg ggcaggttcc tgtggtcact gcccgcctgc gaccacctgc acaagaacga gagcgtactc aaggccaagg cggtggtcgc cttccaccgc ggcaacttcc gtgagctcta caagatcctg gagagccacc agttctcgcc tcacaaccac cccaaactgc agcaactgtg gctgaaggcg cattacgtgg aggccgagaa gctgtgcggc cgacccctgg gcgccgtggg caaatatcgg gtgcgccgaa aatttccact gccgcgcacc atctgggacg gcgaggagac cagctactgc ttcaaggaga agtcgagggg tgtcctgcgg gagtggtacg cgcacaatcc ctacccatcg ccgcgtgaga agcgggagct ggccgaggcc accggcctca ccaccaccca ggtcagcaac tggtttaaga accggaggca aagagaccgg gccgcggagg ccaaggaaag ggagaacacc gaaaacaata actcctcctc caacaagcag aaccaactct ctcctctgga agggggcaag ccgctcatgt ccagctcaga agaggaattc tcacctcccc aaagtccaga ccagaactcg gtccttctgc tgcagggcaa tatgggccac gccaggagct caaactattc tctcccgggc ttaacagcct cgcagcccag tcacggcctg cagacccacc agcatcagct ccaagactct ctgctcggcc ccctcacctc cagtctggtg gacttggggt cctaa. It is sometimes possible for the material contained within the vial of "SIX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.