Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIRT1 cdna clone

SIRT1 cDNA Clone

Gene Names
SIRT1; SIR2; SIR2L1; SIR2alpha
Synonyms
SIRT1; SIRT1 cDNA Clone; SIRT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgattggcacagatcctcgaacaattcttaaagatttattgccggaaacaatacctccacctgagttggatgatatgacactgtggcagattgttattaatatcctttcagaaccaccaaaaaggaaaaaaagaaaagatattaatacaattgaagatgctgtgaaattactgcaagagtgcaaaaaaattatagttctaactggagctggggtgtctgtttcatgtggaatacctgacttcaggtcaagggatggtatttatgctcgccttgctgtagacttcccagatcttccagatcctcaagcgatgtttgatattgaatatttcagaaaagatccaagaccattcttcaagtttgcaaaggaaatatatcctggacaattccagccatctctctgtcacaaattcatagccttgtcagataaggaaggaaaactacttcgcaactatacccagaacatagacacgctggaacaggttgcgggaatccaaaggataattcagtgtcatggttcctttgcaacagcatcttgcctgatttgtaaatacaaagttgactgtgaagctgtacgaggagctctttttagtcaggtagttcctcgatgtcctaggtgcccagctgatgaaccgcttgctatcatgaaaccagagattgtgttttttggtgaaaatttaccagaacagtttcatagagccatgaagtatgacaaagatgaagttgacctcctcattgttattgggtcttccctcaaagtaagaccagtagcactaattccaagttccataccccatgaagtgcctcagatattaattaatagagaacctttgcctcatctgcattttgatgtagagcttcttggagactgtgatgtcataattaatgaattgtgtcataggttaggtggtgaatatgccaaactttgctgtaaccctgtaaagctttcagaaattactgaaaaacctccacgaacacaaaaagaattggcttatttgtcagagttgccacccacacctcttcatgtttcagaagactcaagttcaccagaaagaacttcaccaccagattcttcagtgattgtcacacttttagaccaagcagctaagagtaatgatgatttagatgtgtctgaatcaaaaggttgtatggaagaaaaaccacaggaagtacaaacttctaggaatgttgaaagtattgctgaacagatggaaaatccggatttgaagaatgttggttctagtactggggagaaaaatgaaagaacttcagtggctggaacagtgagaaaatgctggcctaatagagtggcaaaggagcagattagtaggcggcttgatggtaatcagtatctgtttttgccaccaaatcgttacattttccatggcgctgaggtatattcagactctgaagatgacgtcttatcctctagttcttgtggcagtaacagtgatagtgggacatgccagagtccaagtttagaagaacccatggaggatgaaagtgaaattgaagaattctacaatggcttagaagatgagcctgatgttccagagagagctggaggagctggatttgggactgatggagatgatcaagaggcaattaatgaagctatatctgtgaaacaggaagtaacagacatgaactatccatcaaacaaatcatag
Sequence Length
1668
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,066 Da
NCBI Official Full Name
Homo sapiens sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
sirtuin 1
NCBI Official Symbol
SIRT1
NCBI Official Synonym Symbols
SIR2; SIR2L1; SIR2alpha
NCBI Protein Information
NAD-dependent protein deacetylase sirtuin-1
UniProt Protein Name
NAD-dependent protein deacetylase sirtuin-1
UniProt Gene Name
SIRT1
UniProt Synonym Gene Names
SIR2L1; hSIRT1; hSIR2; 75SirT1
UniProt Entry Name
SIR1_HUMAN

NCBI Description

This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]

Uniprot Description

SIRT1: an NAD-dependent protein deacetylase that links transcriptional regulation directly to intracellular energetics and participates in the coordination of several separate cellular functions such as cell cycle, response to DNA damage, metobolism, apoptosis and autophagy. Deacetylates a broad range of transcription factors and coregulators, thereby regulating target gene expression positively and negatively. Serves as a sensor of the cytosolic ratio of NAD(+)/NADH which is altered by glucose deprivation and metabolic changes associated with caloric restriction. Essential in skeletal muscle cell differentiation and in response to low nutrients mediates the inhibitory effect on skeletal myoblast differentiation which also involves 5'-AMP-activated protein kinase (AMPK) and nicotinamide phosphoribosyltransferase (NAMPT). Component of the eNoSC (energy-dependent nucleolar silencing) complex, a complex that mediates silencing of rDNA in response to intracellular energy status and acts by recruiting histone-modifying enzymes. Elevation of NAD(+)/NADP(+) ratio activates SIRT1. Recruited to LRH1 target gene promoters by NR0B2/SHP thereby stimulating histone H3 and H4 deacetylation leading to transcriptional repression. Implicated in regulation of adipogenesis and fat mobilization in white adipocytes by repression of PPARG. Involved in liver and muscle metabolism. Is involved in autophagy, presumably by deacetylating ATG5, ATG7 and ATG8. Deacetylates AKT1 which leads to enhanced binding of AKT1 and PDK1 to PIP3 and promotes their activation. Widely expressed. Inhibited by nicotinamide. Belongs to the sirtuin family. Class I subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.5.1.-; Deacetylase; Apoptosis; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 10q21.3

Cellular Component: chromatin silencing complex; cytoplasm; ESC/E(Z) complex; mitochondrion; nuclear chromatin; nuclear envelope; nuclear heterochromatin; nuclear inner membrane; nucleolus; nucleoplasm; nucleus; PML body

Molecular Function: bHLH transcription factor binding; deacetylase activity; enzyme binding; histone binding; histone deacetylase activity; HLH domain binding; identical protein binding; mitogen-activated protein kinase binding; NAD+ ADP-ribosyltransferase activity; NAD-dependent histone deacetylase activity; NAD-dependent histone deacetylase activity (H3-K9 specific); nuclear hormone receptor binding; p53 binding; protein binding; protein C-terminus binding; protein deacetylase activity; transcription corepressor activity; transcription factor binding

Biological Process: angiogenesis; cell aging; cell glucose homeostasis; cellular response to starvation; cholesterol homeostasis; chromatin silencing; chromatin silencing at rDNA; circadian regulation of gene expression; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; DNA repair; DNA replication; DNA synthesis during DNA repair; establishment and/or maintenance of chromatin architecture; establishment of chromatin silencing; fatty acid homeostasis; histone deacetylation; inhibition of NF-kappaB transcription factor; leptin-mediated signaling pathway; macrophage differentiation; maintenance of chromatin silencing; methylation-dependent chromatin silencing; negative regulation of apoptosis; negative regulation of cell growth; negative regulation of DNA damage response, signal transduction by p53 class mediator; negative regulation of fat cell differentiation; negative regulation of helicase activity; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of phosphorylation; negative regulation of prostaglandin biosynthetic process; negative regulation of protein kinase B signaling cascade; negative regulation of TOR signaling pathway; negative regulation of transcription factor activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; negative regulation of transforming growth factor beta receptor signaling pathway; peptidyl-lysine acetylation; positive regulation of adaptive immune response; positive regulation of angiogenesis; positive regulation of apoptosis; positive regulation of caspase activity; positive regulation of cell proliferation; positive regulation of chromatin silencing; positive regulation of DNA repair; positive regulation of endothelial cell proliferation; positive regulation of histone H3-K9 methylation; positive regulation of insulin receptor signaling pathway; positive regulation of macroautophagy; positive regulation of MHC class II biosynthetic process; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein amino acid phosphorylation; positive regulation of transcription from RNA polymerase II promoter; proteasomal ubiquitin-dependent protein catabolic process; protein amino acid ADP-ribosylation; protein amino acid deacetylation; protein destabilization; protein ubiquitination; pyrimidine dimer repair via nucleotide-excision repair; regulation of cell proliferation; regulation of endodeoxyribonuclease activity; regulation of mitotic cell cycle; regulation of protein import into nucleus, translocation; response to DNA damage stimulus; response to hydrogen peroxide; response to insulin stimulus; response to oxidative stress; single strand break repair; triacylglycerol mobilization; white fat cell differentiation

Research Articles on SIRT1

Similar Products

Product Notes

The SIRT1 sirt1 (Catalog #AAA1271679) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattggca cagatcctcg aacaattctt aaagatttat tgccggaaac aatacctcca cctgagttgg atgatatgac actgtggcag attgttatta atatcctttc agaaccacca aaaaggaaaa aaagaaaaga tattaataca attgaagatg ctgtgaaatt actgcaagag tgcaaaaaaa ttatagttct aactggagct ggggtgtctg tttcatgtgg aatacctgac ttcaggtcaa gggatggtat ttatgctcgc cttgctgtag acttcccaga tcttccagat cctcaagcga tgtttgatat tgaatatttc agaaaagatc caagaccatt cttcaagttt gcaaaggaaa tatatcctgg acaattccag ccatctctct gtcacaaatt catagccttg tcagataagg aaggaaaact acttcgcaac tatacccaga acatagacac gctggaacag gttgcgggaa tccaaaggat aattcagtgt catggttcct ttgcaacagc atcttgcctg atttgtaaat acaaagttga ctgtgaagct gtacgaggag ctctttttag tcaggtagtt cctcgatgtc ctaggtgccc agctgatgaa ccgcttgcta tcatgaaacc agagattgtg ttttttggtg aaaatttacc agaacagttt catagagcca tgaagtatga caaagatgaa gttgacctcc tcattgttat tgggtcttcc ctcaaagtaa gaccagtagc actaattcca agttccatac cccatgaagt gcctcagata ttaattaata gagaaccttt gcctcatctg cattttgatg tagagcttct tggagactgt gatgtcataa ttaatgaatt gtgtcatagg ttaggtggtg aatatgccaa actttgctgt aaccctgtaa agctttcaga aattactgaa aaacctccac gaacacaaaa agaattggct tatttgtcag agttgccacc cacacctctt catgtttcag aagactcaag ttcaccagaa agaacttcac caccagattc ttcagtgatt gtcacacttt tagaccaagc agctaagagt aatgatgatt tagatgtgtc tgaatcaaaa ggttgtatgg aagaaaaacc acaggaagta caaacttcta ggaatgttga aagtattgct gaacagatgg aaaatccgga tttgaagaat gttggttcta gtactgggga gaaaaatgaa agaacttcag tggctggaac agtgagaaaa tgctggccta atagagtggc aaaggagcag attagtaggc ggcttgatgg taatcagtat ctgtttttgc caccaaatcg ttacattttc catggcgctg aggtatattc agactctgaa gatgacgtct tatcctctag ttcttgtggc agtaacagtg atagtgggac atgccagagt ccaagtttag aagaacccat ggaggatgaa agtgaaattg aagaattcta caatggctta gaagatgagc ctgatgttcc agagagagct ggaggagctg gatttgggac tgatggagat gatcaagagg caattaatga agctatatct gtgaaacagg aagtaacaga catgaactat ccatcaaaca aatcatag. It is sometimes possible for the material contained within the vial of "SIRT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.