SIRPD cdna clone
SIRPD cDNA Clone
Gene Names
SIRPD; PTPNS1L2; dJ576H24.4
Synonyms
SIRPD; SIRPD cDNA Clone; SIRPD cdna clone
Sequence
atgcccatccctgcctccccactccacccacctctgccttccttactgctgtatctgctgcttgaactggcaggagtcacacatgtgttccatgtgcaacaaacggagatgtcacagactgtatcaactggggagtcaatcatcttgagttgcagcgtacccgataccttaccaaatggacctgtcttgtggttcaagggaacagggccaaaccggaaattaatctacaatttcaaacaaggtaactttcccagagtaaaagagattggagacaccaccaagcctggcaacacagacttttccacccgcatccgtgaaatctctcttgctgatgctggcacctattactgcgtgaagttcataaaaggaagagctatcaaggagtaccaatcaggtcggggcactcaggtgtttgttactgagcagaatccaagacctcccaagaacagacctgcaggcagagcaggctccagggcccaccatgatgcccatacctgcctctcggccctgcctgagagaaacagcacaaactatttcgtccaaccctgctgctgcctccggctgctgggactcacaggcttgctgtcaaaataa
Sequence Length
594
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,687 Da
NCBI Official Full Name
Homo sapiens signal-regulatory protein delta, mRNA
NCBI Official Synonym Full Names
signal regulatory protein delta
NCBI Official Symbol
SIRPD
NCBI Official Synonym Symbols
PTPNS1L2; dJ576H24.4
NCBI Protein Information
signal-regulatory protein delta
UniProt Protein Name
Signal-regulatory protein delta
Protein Family
UniProt Gene Name
SIRPD
UniProt Synonym Gene Names
PTPNS1L2; SIRP-delta
UniProt Entry Name
SIRPD_HUMAN
Uniprot Description
SIRPD:
Protein type: Secreted; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 20p13
Similar Products
Product Notes
The SIRPD sirpd (Catalog #AAA1268885) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccatcc ctgcctcccc actccaccca cctctgcctt ccttactgct gtatctgctg cttgaactgg caggagtcac acatgtgttc catgtgcaac aaacggagat gtcacagact gtatcaactg gggagtcaat catcttgagt tgcagcgtac ccgatacctt accaaatgga cctgtcttgt ggttcaaggg aacagggcca aaccggaaat taatctacaa tttcaaacaa ggtaactttc ccagagtaaa agagattgga gacaccacca agcctggcaa cacagacttt tccacccgca tccgtgaaat ctctcttgct gatgctggca cctattactg cgtgaagttc ataaaaggaa gagctatcaa ggagtaccaa tcaggtcggg gcactcaggt gtttgttact gagcagaatc caagacctcc caagaacaga cctgcaggca gagcaggctc cagggcccac catgatgccc atacctgcct ctcggccctg cctgagagaa acagcacaaa ctatttcgtc caaccctgct gctgcctccg gctgctggga ctcacaggct tgctgtcaaa ataa. It is sometimes possible for the material contained within the vial of "SIRPD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
