Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

SIN3A cdna clone

SIN3A cDNA Clone

Gene Names
SIN3A; WITKOS
Synonyms
SIN3A; SIN3A cDNA Clone; SIN3A cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgaagcggcgtttggatgaccaggagtcaccggtgtatgcagcccagcagcgtcggatccctggcagcacagaggcttttcctcaccagcaccgggtgcttgcccctgcccctcctgtgtatgaagcagtgtctgagaccatgcagtcagctacgggaattcagtactctgtaacacccagctaccaggtttcagccatgccacagagctccggcagtcatgggcccgctatagcagcagttcatagcagccatcatcacccaacagcggtgcagccccacggaggccaggtggtccagagtcatgctcatccagccccaccagttgcaccagtgcagggacagcagcaatttcagaggctgaaggtggtattcagctctttttcttgggtcaaaaaatttatctttagcaggaaatactggttgcagcttgttggttgtggtggtacaacttctaacctgagatactag
Sequence Length
471
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
145,175 Da
NCBI Official Full Name
Homo sapiens SIN3 homolog A, transcription regulator (yeast), mRNA
NCBI Official Synonym Full Names
SIN3 transcription regulator family member A
NCBI Official Symbol
SIN3A
NCBI Official Synonym Symbols
WITKOS
NCBI Protein Information
paired amphipathic helix protein Sin3a
UniProt Protein Name
Paired amphipathic helix protein Sin3a
UniProt Gene Name
SIN3A
UniProt Entry Name
SIN3A_HUMAN

NCBI Description

The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]

Uniprot Description

SIN3A: Acts as a transcriptional repressor. Corepressor for REST. Interacts with MXI1 to repress MYC responsive genes and antagonize MYC oncogenic activities. Also interacts with MXD1-MAX heterodimers to repress transcription by tethering SIN3A to DNA. Acts cooperatively with OGT to repress transcription in parallel with histone deacetylation. Interacts with BAZ2A, MXD3, MXD4, MBD2, NCOR1, NR4A2, REST, RLIM, SAP30, SETDB1 and SMYD2. Interacts with PHF12 in a complex composed of HDAC1, PHF12 and SAP30. Interacts with ARID4B, BRMS1L, DACH1, HCFC1, HDAC1, HDAC2, MXI1, SAP30L, SAP130, SFPQ, SUDS3 and TOPORS. Interacts with TET1; the interaction recruits SIN3A to gene promoters. Interacts with OGT (via TPRs 1-6); the interaction mediates transcriptional repression in parallel with histone deacetylase.

Protein type: Nucleolus; Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 15q24.2

Cellular Component: cytoplasm; intercellular bridge; nucleoplasm; nucleus; Sin3 complex

Molecular Function: histone deacetylase activity; protein binding; protein deacetylase activity

Biological Process: activation of innate immune response; cellular lipid metabolic process; histone deacetylation; negative regulation of circadian rhythm; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of chromatin silencing; positive regulation of defense response to virus by host; positive regulation of transcription from RNA polymerase II promoter; protein amino acid deacetylation

Research Articles on SIN3A

Similar Products

Product Notes

The SIN3A sin3a (Catalog #AAA1274897) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcggc gtttggatga ccaggagtca ccggtgtatg cagcccagca gcgtcggatc cctggcagca cagaggcttt tcctcaccag caccgggtgc ttgcccctgc ccctcctgtg tatgaagcag tgtctgagac catgcagtca gctacgggaa ttcagtactc tgtaacaccc agctaccagg tttcagccat gccacagagc tccggcagtc atgggcccgc tatagcagca gttcatagca gccatcatca cccaacagcg gtgcagcccc acggaggcca ggtggtccag agtcatgctc atccagcccc accagttgca ccagtgcagg gacagcagca atttcagagg ctgaaggtgg tattcagctc tttttcttgg gtcaaaaaat ttatctttag caggaaatac tggttgcagc ttgttggttg tggtggtaca acttctaacc tgagatacta g. It is sometimes possible for the material contained within the vial of "SIN3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual