SIGLEC6 cdna clone

SIGLEC6 cDNA Clone

Gene Names

SIGLEC6; CD327; CD33L; OBBP1; CD33L1; CD33L2; CDW327

Synonyms

SIGLEC6; SIGLEC6 cDNA Clone; SIGLEC6 cdna clone

Ordering
Cat. Num. AAA1269431 For Research Use Only!

Sequence

atgcagggagcccaggaagcctccgcctcagagatgctaccgctgctgctgcccctgctgtgggcaggggccctggctcaggagcggagattccagctggaggggccagagtcactgacggtgcaggagggtctgtgcgtcctcgtaccctgcagattgcccactacccttccagcctcgtactatggttatggctactggttcctggaaggggctgatgttccagtggccacaaacgacccagacgaagaagtgcaggaggagacccggggccgattccacctcctctgggatcccagaaggaagaactgctccctgagcatcagagatgcccggaggagggacaatgctgcatacttctttcggttgaagtccaaatggatgaaatacggttatacatcttccaagctctctgtgcgtgtgatggccctgacccacaggcccaacatctccatcccagggaccctggagtctggccatcccagcaatctgacctgctctgtgccctgggtctgtgagcaggggacgccccccatcttctcctggatgtcagctgcccccacctccctgggccccaggaccacccagtcctcggtgctcacaatcaccccacggccccaggaccacagcaccaacctcacctgtcaggtgacgttccctggagccggtgtgaccatggagagaaccatccagctcaatgtctcctccttcaaaatcctgcaaaacacctcgtccctccctgtcctggagggccaggctctgcggctgctctgtgatgctgacggcaacccccctgcacacctgagctggttccagggcttccccgccctgaacgccacccccatctccaataccggggtcctggagctgcctcaagtagggtctgcagaagaaggagatttcacctgccgtgctcagcatcctctgggctccctgcaaatctctctgagtctctttgtgcattggaaaccagaaggcagggctggtggtgtcctgggagcagtctggggagctagcatcacaaccctggttttcctctgtgtttgcttcatcttcagagtgaagactagaaggaagaaagcagcccagccagtgcaaaacacggatgatgtgaaccccgtcatggtctcaggctccaggggtcatcagcaccagttccagacaggcatagtttcagaccaccctgctgaggctggccccatctcagaagatgagcaggagctccactacgctgtcctacacttccacaaggtgcaacctcaggaaccaaaggtcaccgacactgagtactcagaaatcaagatacacaagtga

Sequence Length

1314

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

23273974

NCBI GeneID

946

Molecular Weight

44,348 Da

NCBI Official Full Name

Homo sapiens sialic acid binding Ig-like lectin 6, mRNA

NCBI Official Synonym Full Names

sialic acid binding Ig like lectin 6

NCBI Official Symbol

SIGLEC6

NCBI Official Synonym Symbols

CD327; CD33L; OBBP1; CD33L1; CD33L2; CDW327

NCBI Protein Information

sialic acid-binding Ig-like lectin 6

UniProt Protein Name

Sialic acid-binding Ig-like lectin 6

Protein Family

Sialic acid-binding Ig-like lectin

UniProt Gene Name

SIGLEC6

UniProt Synonym Gene Names

CD33L; CD33L1; OBBP1; Siglec-6; OB-BP1

UniProt Entry Name

SIGL6_HUMAN

NCBI Description

This gene encodes a member of the SIGLEC (sialic acid binding immunoglobulin-like lectin) family of proteins. The encoded transmembrane receptor binds sialyl-TN glycans and leptin. Placental expression of the encoded protein is upregulated in preeclampsia. [provided by RefSeq, Jul 2016]

Uniprot Description

SIGLEC6: Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: integral to plasma membrane; membrane

Molecular Function: protein binding

Biological Process: cell-cell signaling

Research Articles on SIGLEC6

1. Siglec6 and leptin play a role in the aberrant properties characteristic of gestational trophoblastic disease, namely excess proliferation and invasion.

Similar Products

Product Notes

The SIGLEC6 siglec6 (Catalog #AAA1269431) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagggag cccaggaagc ctccgcctca gagatgctac cgctgctgct gcccctgctg tgggcagggg ccctggctca ggagcggaga ttccagctgg aggggccaga gtcactgacg gtgcaggagg gtctgtgcgt cctcgtaccc tgcagattgc ccactaccct tccagcctcg tactatggtt atggctactg gttcctggaa ggggctgatg ttccagtggc cacaaacgac ccagacgaag aagtgcagga ggagacccgg ggccgattcc acctcctctg ggatcccaga aggaagaact gctccctgag catcagagat gcccggagga gggacaatgc tgcatacttc tttcggttga agtccaaatg gatgaaatac ggttatacat cttccaagct ctctgtgcgt gtgatggccc tgacccacag gcccaacatc tccatcccag ggaccctgga gtctggccat cccagcaatc tgacctgctc tgtgccctgg gtctgtgagc aggggacgcc ccccatcttc tcctggatgt cagctgcccc cacctccctg ggccccagga ccacccagtc ctcggtgctc acaatcaccc cacggcccca ggaccacagc accaacctca cctgtcaggt gacgttccct ggagccggtg tgaccatgga gagaaccatc cagctcaatg tctcctcctt caaaatcctg caaaacacct cgtccctccc tgtcctggag ggccaggctc tgcggctgct ctgtgatgct gacggcaacc cccctgcaca cctgagctgg ttccagggct tccccgccct gaacgccacc cccatctcca ataccggggt cctggagctg cctcaagtag ggtctgcaga agaaggagat ttcacctgcc gtgctcagca tcctctgggc tccctgcaaa tctctctgag tctctttgtg cattggaaac cagaaggcag ggctggtggt gtcctgggag cagtctgggg agctagcatc acaaccctgg ttttcctctg tgtttgcttc atcttcagag tgaagactag aaggaagaaa gcagcccagc cagtgcaaaa cacggatgat gtgaaccccg tcatggtctc aggctccagg ggtcatcagc accagttcca gacaggcata gtttcagacc accctgctga ggctggcccc atctcagaag atgagcagga gctccactac gctgtcctac acttccacaa ggtgcaacct caggaaccaa aggtcaccga cactgagtac tcagaaatca agatacacaa gtga. It is sometimes possible for the material contained within the vial of "SIGLEC6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SIGLEC6 cdna clone