SIGIRR cdna clone
SIGIRR cDNA Clone
Gene Names
SIGIRR; TIR8; IL-1R8
Synonyms
SIGIRR; SIGIRR cDNA Clone; SIGIRR cdna clone
Sequence
atgccaggtgtctgtgatagggcccctgacttcctctccccgtctgaagaccaggtgctgaggcctgccttgggcagctcagtggctctgaactgcacggcttgggtagtctctgggccccactgctccctgccttcagtccagtggctgaaagacgggcttccattgggaattgggggccactacagcctccacgagtactcctgggtcaaggccaacctgtcagaggtgcttgtgtccagtgtcctgggggtcaacgtgaccagcactgaagtctatggggccttcacctgctccatccagaacatcagcttctcctccttcactcttcagagagctggccctacaagccacgtggctgcggtgctggcctccctcctggtcctgctggccctgctgctggccgccctgctctatgtcaagtgccgtctcaacgtgctgctctggtaccaggacgcgtatggggaggtggagataaacgacgggaagctctacgacgcctacgtctcctacagcgactgccccgaggaccgcaagttcgtgaacttcatcctaaagccgcagctggagcggcgtcggggctacaagctcttcctggacgaccgcgacctcctgccgcgcgctgagccctccgccgacctcttggtgaacctgagccgctgccgacgcctcatcgtggtgctttcggacgccttcctgagccgggcctggtgcagccacagcttccgggagggcctgtgccggctgctggagctcacccgcagacccatcttcatcaccttcgagggccagaggcgcgaccccgcgcacccggcgctccgcctgctgcgccagcaccgccacctggtgaccttgctgctctggaggcccggctccgtgactccttcctccgatttttggaaagaagtgcagctggcgctgccgcggaaggtgcggtacaggccggtggaaggagacccccagacgcagctgcaggacgacaaggaccccatgctgattcttcgaggccgagtccctgagggccgggccctggactcagaggtggacccggaccctgagggcgacctgggtgtccgggggcctgtttttggagagccatcagctccaccgcacaccagtggggtctcgctgggagagagccggagcagcgaagtggacgtctcggatctcggctcgcgaaactacagtgcccgcacagacttctactgcctggtgtccaaggatgatatgtag
Sequence Length
1233
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,271 Da
NCBI Official Full Name
Homo sapiens single immunoglobulin and toll-interleukin 1 receptor (TIR) domain, mRNA
NCBI Official Synonym Full Names
single Ig and TIR domain containing
NCBI Official Symbol
SIGIRR
NCBI Official Synonym Symbols
TIR8; IL-1R8
NCBI Protein Information
single Ig IL-1-related receptor
UniProt Protein Name
Single Ig IL-1-related receptor
Protein Family
UniProt Gene Name
SIGIRR
UniProt Synonym Gene Names
TIR8
UniProt Entry Name
SIGIR_HUMAN
Uniprot Description
SIGIRR: Acts as a negative regulator of the Toll-like and IL-1R receptor signaling pathways. Attenuates the recruitment of receptor-proximal signaling components to the TLR4 receptor, probably through an TIR-TIR domain interaction with TLR4. Through its extracellular domain interferes with the heterodimerization of Il1R1 and IL1RAP. Belongs to the interleukin-1 receptor family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Receptor, misc.; Membrane protein, integral
Chromosomal Location of Human Ortholog: 11p15.5
Cellular Component: membrane
Molecular Function: protein binding
Biological Process: acute-phase response; negative regulation of chemokine biosynthetic process; negative regulation of cytokine and chemokine mediated signaling pathway; negative regulation of lipopolysaccharide-mediated signaling pathway; negative regulation of transcription factor activity
Research Articles on SIGIRR
Similar Products
Product Notes
The SIGIRR sigirr (Catalog #AAA1267250) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaggtg tctgtgatag ggcccctgac ttcctctccc cgtctgaaga ccaggtgctg aggcctgcct tgggcagctc agtggctctg aactgcacgg cttgggtagt ctctgggccc cactgctccc tgccttcagt ccagtggctg aaagacgggc ttccattggg aattgggggc cactacagcc tccacgagta ctcctgggtc aaggccaacc tgtcagaggt gcttgtgtcc agtgtcctgg gggtcaacgt gaccagcact gaagtctatg gggccttcac ctgctccatc cagaacatca gcttctcctc cttcactctt cagagagctg gccctacaag ccacgtggct gcggtgctgg cctccctcct ggtcctgctg gccctgctgc tggccgccct gctctatgtc aagtgccgtc tcaacgtgct gctctggtac caggacgcgt atggggaggt ggagataaac gacgggaagc tctacgacgc ctacgtctcc tacagcgact gccccgagga ccgcaagttc gtgaacttca tcctaaagcc gcagctggag cggcgtcggg gctacaagct cttcctggac gaccgcgacc tcctgccgcg cgctgagccc tccgccgacc tcttggtgaa cctgagccgc tgccgacgcc tcatcgtggt gctttcggac gccttcctga gccgggcctg gtgcagccac agcttccggg agggcctgtg ccggctgctg gagctcaccc gcagacccat cttcatcacc ttcgagggcc agaggcgcga ccccgcgcac ccggcgctcc gcctgctgcg ccagcaccgc cacctggtga ccttgctgct ctggaggccc ggctccgtga ctccttcctc cgatttttgg aaagaagtgc agctggcgct gccgcggaag gtgcggtaca ggccggtgga aggagacccc cagacgcagc tgcaggacga caaggacccc atgctgattc ttcgaggccg agtccctgag ggccgggccc tggactcaga ggtggacccg gaccctgagg gcgacctggg tgtccggggg cctgtttttg gagagccatc agctccaccg cacaccagtg gggtctcgct gggagagagc cggagcagcg aagtggacgt ctcggatctc ggctcgcgaa actacagtgc ccgcacagac ttctactgcc tggtgtccaa ggatgatatg tag. It is sometimes possible for the material contained within the vial of "SIGIRR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
