SH3GL3 cdna clone
SH3GL3 cDNA Clone
Gene Names
SH3GL3; CNSA3; EEN-B2; SH3D2C; SH3P13; HsT19371
Synonyms
SH3GL3; SH3GL3 cDNA Clone; SH3GL3 cdna clone
Sequence
atgtcggtggccgggctgaagaagcagttccacaaagccagccagctatttagtgaaaaaataagtggtgctgaaggaactaaactagacgatgaatttcttgacatggaaaggaaaatagatgttaccaataaagttgttgcagaaattctttcaaaaaccactgaatatcttcagccaaatccagcatacagagctaagctaggaatgctgaacactgtgtcgaagatccgagggcaggtgaagaccacaggatacccgcagacggaaggcttgctgggggactgtatgctgaaatacgggaaggagctcggggaagactccacctttggcaatgcattgatagaagttggtgaatccatgaagctaatggctgaggtgaaagactctcttgatattaatgtaaagcaaacttttattgatccacttcagttactacaagataaagatttaaaagagatcgggcatcacctgaaaaagctggaaggccgccgcctggattacgattataaaaagaaacgagtaggtaagataccagacgaagaagtcagacaagcggtagaaaaatttgaagagtcaaaggagttggctgaaagaagcatgtttaactttttagaaaatgatgtagaacaagtcagccagttggctgtgttcatagaggcagcattagactatcacagacagtccacagagattctgcaggagctgcagagcaagctacagatgcgaatatcagctgcatccagtgtccccagacgagaatacaagccaaggcctgtgaaaaggagttctagtgagctcaatggagtttccaccacctctgtagtgaagacgacagcctacagcagactggaaccagcagattag
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,739 Da
NCBI Official Full Name
Homo sapiens SH3-domain GRB2-like 3, mRNA
NCBI Official Synonym Full Names
SH3 domain containing GRB2 like 3, endophilin A3
NCBI Official Symbol
SH3GL3
NCBI Official Synonym Symbols
CNSA3; EEN-B2; SH3D2C; SH3P13; HsT19371
NCBI Protein Information
endophilin-A3
UniProt Protein Name
Endophilin-A3
Protein Family
UniProt Gene Name
SH3GL3
UniProt Synonym Gene Names
CNSA3; SH3D2C
UniProt Entry Name
SH3G3_HUMAN
Uniprot Description
SH3GL3: Implicated in endocytosis. May recruit other proteins to membranes with high curvature. Belongs to the endophilin family. 4 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 15q24
Molecular Function: identical protein binding; protein binding
Biological Process: central nervous system development; signal transduction
Research Articles on SH3GL3
Similar Products
Product Notes
The SH3GL3 sh3gl3 (Catalog #AAA1275440) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtgg ccgggctgaa gaagcagttc cacaaagcca gccagctatt tagtgaaaaa ataagtggtg ctgaaggaac taaactagac gatgaatttc ttgacatgga aaggaaaata gatgttacca ataaagttgt tgcagaaatt ctttcaaaaa ccactgaata tcttcagcca aatccagcat acagagctaa gctaggaatg ctgaacactg tgtcgaagat ccgagggcag gtgaagacca caggataccc gcagacggaa ggcttgctgg gggactgtat gctgaaatac gggaaggagc tcggggaaga ctccaccttt ggcaatgcat tgatagaagt tggtgaatcc atgaagctaa tggctgaggt gaaagactct cttgatatta atgtaaagca aacttttatt gatccacttc agttactaca agataaagat ttaaaagaga tcgggcatca cctgaaaaag ctggaaggcc gccgcctgga ttacgattat aaaaagaaac gagtaggtaa gataccagac gaagaagtca gacaagcggt agaaaaattt gaagagtcaa aggagttggc tgaaagaagc atgtttaact ttttagaaaa tgatgtagaa caagtcagcc agttggctgt gttcatagag gcagcattag actatcacag acagtccaca gagattctgc aggagctgca gagcaagcta cagatgcgaa tatcagctgc atccagtgtc cccagacgag aatacaagcc aaggcctgtg aaaaggagtt ctagtgagct caatggagtt tccaccacct ctgtagtgaa gacgacagcc tacagcagac tggaaccagc agattag. It is sometimes possible for the material contained within the vial of "SH3GL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
