Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SH3BGRL2 cdna clone

SH3BGRL2 cDNA Clone

Synonyms
SH3BGRL2; SH3BGRL2 cDNA Clone; SH3BGRL2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGTCATCCGCGTGTTCATCGCCTCTTCCTCGGGCTTCGTGGCGATAAAGAAGAAGCAGCAAGATGTGGTTAGATTTCTGGAAGCCAACAAGATAGAGTTTGAGGAGGTGGATACCACAATGTCAGAAGAACAGAGGCAATGGATGTACAAAAACGTCCCCCCGGAAAAGAAACCCACTCAGGGCAACCCCCTGCCACCTCAGATATTTAATGGCGACCGATACTGTGGAGATTATGACAGTTTTTTTGAATCCAAGGAAAGCAACACAGTCTTTTCATTTTTAGGCCTGAAACCACGGTTGGCATCAAAGGCAGAACCTTAG
Sequence Length
324
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,326 Da
NCBI Official Full Name
Homo sapiens SH3 domain binding glutamic acid-rich protein like 2, mRNA
NCBI Official Synonym Full Names
SH3 domain binding glutamate rich protein like 2
NCBI Official Symbol
SH3BGRL2
NCBI Protein Information
SH3 domain-binding glutamic acid-rich-like protein 2
UniProt Protein Name
SH3 domain-binding glutamic acid-rich-like protein 2
UniProt Gene Name
SH3BGRL2
UniProt Synonym Gene Names
FASH3
UniProt Entry Name
SH3L2_HUMAN

Uniprot Description

SH3BGRL2: Belongs to the SH3BGR family.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 6q14.1

Cellular Component: nucleoplasm

Research Articles on SH3BGRL2

Similar Products

Product Notes

The SH3BGRL2 sh3bgrl2 (Catalog #AAA1273661) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGTCATCC GCGTGTTCAT CGCCTCTTCC TCGGGCTTCG TGGCGATAAA GAAGAAGCAG CAAGATGTGG TTAGATTTCT GGAAGCCAAC AAGATAGAGT TTGAGGAGGT GGATACCACA ATGTCAGAAG AACAGAGGCA ATGGATGTAC AAAAACGTCC CCCCGGAAAA GAAACCCACT CAGGGCAACC CCCTGCCACC TCAGATATTT AATGGCGACC GATACTGTGG AGATTATGAC AGTTTTTTTG AATCCAAGGA AAGCAACACA GTCTTTTCAT TTTTAGGCCT GAAACCACGG TTGGCATCAA AGGCAGAACC TTAG. It is sometimes possible for the material contained within the vial of "SH3BGRL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.