Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SFRP4 cdna clone

SFRP4 cDNA Clone

Gene Names
SFRP4; PYL; FRP-4; FRPHE; sFRP-4
Synonyms
SFRP4; SFRP4 cDNA Clone; SFRP4 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcctctccatcctagtggcgctgtgcctgtggctgcacctggcgctgggcgtgcgcggcgcgccctgcgaggcggtgcgcatccctatgtgccggcacatgccctggaacatcacgcggatgcccaaccacctgcaccacagcacgcaggagaacgccatcctggccatcgagcagtacgaggagctggtggacgtgaactgcagcgccgtgctgcgcttcttcctctgtgccatgtacgcgcccatttgcaccctggagttcctgcacgaccctatcaagccgtgcaagtcggtgtgccaacgcgcgcgcgacgactgcgagcccctcatgaagatgtacaaccacagctggcccgaaagcctggcctgcgacgagctgcctgtctatgaccgtggcgtgtgcatctcgcctgaagccatcgtcacggacctcccggaggatgttaagtggatagacatcacaccagacatgatggtacaggaaaggcctcttgatgttgactgtaaacgcctaagccccgatcggtgcaagtgtaaaaaggtgaagccaactttggcaacgtatctcagcaaaaactacagctatgttattcatgccaaaataaaagctgtgcagaggagtggctgcaatgaggtcacaacggtggtggatgtaaaagagatcttcaagtcctcatcacccatccctcgaactcaagtcccgctcattacaaattcttcttgccagtgtccacacatcctgccccatcaagatgttctcatcatgtgttacgagtggcgttcaaggatgatgcttcttgaaaattgcttagttgaaaaatggagagatcagcttagtaaaagatccatacagtgggaagagaggctgcaggaacagcggagaacagttcaggacaagaagaaaacagccgggcgcaccagtcgtagtaatccccccaaaccaaagggaaagcctcctgctcccaaaccagccagtcccaagaagaacattaaaactaggagtgcccagaagagaacaaacccgaaaagagtgtga
Sequence Length
1041
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,827 Da
NCBI Official Full Name
Homo sapiens secreted frizzled-related protein 4, mRNA
NCBI Official Synonym Full Names
secreted frizzled related protein 4
NCBI Official Symbol
SFRP4
NCBI Official Synonym Symbols
PYL; FRP-4; FRPHE; sFRP-4
NCBI Protein Information
secreted frizzled-related protein 4
UniProt Protein Name
Secreted frizzled-related protein 4
UniProt Gene Name
SFRP4
UniProt Synonym Gene Names
FRPHE; sFRP-4; FrpHE
UniProt Entry Name
SFRP4_HUMAN

NCBI Description

Secreted frizzled-related protein 4 (SFRP4) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. The expression of SFRP4 in ventricular myocardium correlates with apoptosis related gene expression. [provided by RefSeq, Jul 2008]

Uniprot Description

SFRP4: Soluble frizzled-related proteins (sFRPS) function as modulators of Wnt signaling through direct interaction with Wnts. They have a role in regulating cell growth and differentiation in specific cell types. SFRP4 may act as a regulator of adult uterine morphology and function. Increases apoptosis during ovulation possibly through modulation of FZ1/FZ4/WNT4 signaling. Has phosphaturic effects by specifically inhibiting sodium-dependent phosphate uptake. Belongs to the secreted frizzled-related protein (sFRP) family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 7p14.1

Cellular Component: cell surface; cytoplasm; extracellular space; integral to membrane; nucleus

Molecular Function: G-protein coupled receptor activity; protein binding; Wnt receptor activity; Wnt-protein binding

Biological Process: negative regulation of cell proliferation; negative regulation of transcription factor activity; phosphate ion homeostasis; positive regulation of apoptosis; positive regulation of epidermal cell differentiation; positive regulation of receptor internalization

Disease: Pyle Disease

Research Articles on SFRP4

Similar Products

Product Notes

The SFRP4 sfrp4 (Catalog #AAA1267299) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcctct ccatcctagt ggcgctgtgc ctgtggctgc acctggcgct gggcgtgcgc ggcgcgccct gcgaggcggt gcgcatccct atgtgccggc acatgccctg gaacatcacg cggatgccca accacctgca ccacagcacg caggagaacg ccatcctggc catcgagcag tacgaggagc tggtggacgt gaactgcagc gccgtgctgc gcttcttcct ctgtgccatg tacgcgccca tttgcaccct ggagttcctg cacgacccta tcaagccgtg caagtcggtg tgccaacgcg cgcgcgacga ctgcgagccc ctcatgaaga tgtacaacca cagctggccc gaaagcctgg cctgcgacga gctgcctgtc tatgaccgtg gcgtgtgcat ctcgcctgaa gccatcgtca cggacctccc ggaggatgtt aagtggatag acatcacacc agacatgatg gtacaggaaa ggcctcttga tgttgactgt aaacgcctaa gccccgatcg gtgcaagtgt aaaaaggtga agccaacttt ggcaacgtat ctcagcaaaa actacagcta tgttattcat gccaaaataa aagctgtgca gaggagtggc tgcaatgagg tcacaacggt ggtggatgta aaagagatct tcaagtcctc atcacccatc cctcgaactc aagtcccgct cattacaaat tcttcttgcc agtgtccaca catcctgccc catcaagatg ttctcatcat gtgttacgag tggcgttcaa ggatgatgct tcttgaaaat tgcttagttg aaaaatggag agatcagctt agtaaaagat ccatacagtg ggaagagagg ctgcaggaac agcggagaac agttcaggac aagaagaaaa cagccgggcg caccagtcgt agtaatcccc ccaaaccaaa gggaaagcct cctgctccca aaccagccag tcccaagaag aacattaaaa ctaggagtgc ccagaagaga acaaacccga aaagagtgtg a. It is sometimes possible for the material contained within the vial of "SFRP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.