Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPING1 cdna clone

SERPING1 cDNA Clone

Gene Names
SERPING1; C1IN; C1NH; HAE1; HAE2; C1INH
Synonyms
SERPING1; SERPING1 cDNA Clone; SERPING1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctccaggctgaccctgctgaccctcctgctgctgctgctggctggggatagagcctcctcaaatccaaatgctaccagctccagctcccaggatccagagagtttgcaagacagaggcgaagggaaggtcgcaacaacagttatctccaagatgctattcgttgaacccatcctggaggtttccagcttgccgacaaccaactcaacaaccaattcagccaccaaaataacagctaataccactgatgaacccaccacacaacccaccacagagcccaccacccaacccaccatccaacccacccaaccaactacccagctcccaacagattctcctacccagcccactactgggtccttctgcccaggacctgttactctctgctctgacttggagagtcattcaacagaggccgtgttgggggatgctttggtagatttctccctgaagctctaccacgccttctcagcaatgaagaaggtggagaccaacatggccttttccccattcagcatcgccagcctccttacccaggtcctgctcggggctggggagaacaccaaaacaaacctggagagcatcctctcttaccccaaggacttcacctgtgtccaccaggccctgaagggcttcacgaccaaaggtgtcacctcagtctctcagatcttccacagcccagacctggccataagggacacctttgtgaatgcctctcggaccctgtacagcagcagccccagagtcctaagcaacaacagtgacgccaacttggagctcatcaacacctgggtggccaagaacaccaacaacaagatcagccggctgctagacagtctgccctccgatacccgccttgtcctcctcaatgctatctacctgagtgccaagtggaagacaacatttgatcccaagaaaaccagaatggaaccctttcacttcaaaaactcagttataaaagtgcccatgatgaatagcaagaagtaccctgtggcccatttcattgaccaaactttgaaagccaaggtggggcagctgcagctctcccacaatctgagtttggtgatcctggtaccccagaacctgaaacatcgtcttgaagacatggaacaggctctcagcccttctgttttcaaggccatcatggagaaactggagatgtccaagttccagcccactctcctaacactaccccgcatcaaagtgacgaccagccaggatatgctctcaatcatggagaaattggaattcttcgatttttcttatgaccttaacctgtgtgggctgacagaggacccagatcttcaggtttctgcgatgcagcaccagacagtgctggaactgacagagactggggtggaggcggctgcagcctccgccatctctgtggcccgcaccctgctggtctttgaagtgcagcagcccttcctcttcatgctctgggaccagcagcacaagttccctgtcttcatggggcgagtatatgaccccagggcctga
Sequence Length
1503
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
710
Molecular Weight
55,769 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), member 1, mRNA
NCBI Official Synonym Full Names
serpin family G member 1
NCBI Official Symbol
SERPING1
NCBI Official Synonym Symbols
C1IN; C1NH; HAE1; HAE2; C1INH
NCBI Protein Information
plasma protease C1 inhibitor
UniProt Protein Name
Plasma protease C1 inhibitor
UniProt Gene Name
SERPING1
UniProt Synonym Gene Names
C1IN; C1NH; C1 Inh; C1Inh
UniProt Entry Name
IC1_HUMAN

NCBI Description

This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its protein inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. Deficiency of this protein is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, Jul 2008]

Uniprot Description

SERPING1: a protein protease inhibitor (C1-inhibitor) that forms a proteolytically inactive stoichiometric complex with the C1r or C1s proteases. May play an important role in regulating complement activation, blood coagulation, fibrinolysis and the generation of kinins. Very efficient inhibitor of FXIIa. Mutations of the SERPING1 gene is associated with adult macular degeneration can also cause hereditary angioedema. Binds to E.coli stcE which allows localization of SERPING1 to cell membranes thus protecting the bacteria against complement-mediated lysis. Belongs to the serpin family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 11q12.1

Cellular Component: extracellular region; extracellular space

Molecular Function: protein binding; serine-type endopeptidase inhibitor activity

Biological Process: blood circulation; blood coagulation, intrinsic pathway; negative regulation of complement activation, lectin pathway; platelet degranulation

Disease: Angioedema, Hereditary, Type I; Complement Component 4, Partial Deficiency Of

Research Articles on SERPING1

Similar Products

Product Notes

The SERPING1 serping1 (Catalog #AAA1273149) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcca ggctgaccct gctgaccctc ctgctgctgc tgctggctgg ggatagagcc tcctcaaatc caaatgctac cagctccagc tcccaggatc cagagagttt gcaagacaga ggcgaaggga aggtcgcaac aacagttatc tccaagatgc tattcgttga acccatcctg gaggtttcca gcttgccgac aaccaactca acaaccaatt cagccaccaa aataacagct aataccactg atgaacccac cacacaaccc accacagagc ccaccaccca acccaccatc caacccaccc aaccaactac ccagctccca acagattctc ctacccagcc cactactggg tccttctgcc caggacctgt tactctctgc tctgacttgg agagtcattc aacagaggcc gtgttggggg atgctttggt agatttctcc ctgaagctct accacgcctt ctcagcaatg aagaaggtgg agaccaacat ggccttttcc ccattcagca tcgccagcct ccttacccag gtcctgctcg gggctgggga gaacaccaaa acaaacctgg agagcatcct ctcttacccc aaggacttca cctgtgtcca ccaggccctg aagggcttca cgaccaaagg tgtcacctca gtctctcaga tcttccacag cccagacctg gccataaggg acacctttgt gaatgcctct cggaccctgt acagcagcag ccccagagtc ctaagcaaca acagtgacgc caacttggag ctcatcaaca cctgggtggc caagaacacc aacaacaaga tcagccggct gctagacagt ctgccctccg atacccgcct tgtcctcctc aatgctatct acctgagtgc caagtggaag acaacatttg atcccaagaa aaccagaatg gaaccctttc acttcaaaaa ctcagttata aaagtgccca tgatgaatag caagaagtac cctgtggccc atttcattga ccaaactttg aaagccaagg tggggcagct gcagctctcc cacaatctga gtttggtgat cctggtaccc cagaacctga aacatcgtct tgaagacatg gaacaggctc tcagcccttc tgttttcaag gccatcatgg agaaactgga gatgtccaag ttccagccca ctctcctaac actaccccgc atcaaagtga cgaccagcca ggatatgctc tcaatcatgg agaaattgga attcttcgat ttttcttatg accttaacct gtgtgggctg acagaggacc cagatcttca ggtttctgcg atgcagcacc agacagtgct ggaactgaca gagactgggg tggaggcggc tgcagcctcc gccatctctg tggcccgcac cctgctggtc tttgaagtgc agcagccctt cctcttcatg ctctgggacc agcagcacaa gttccctgtc ttcatggggc gagtatatga ccccagggcc tga. It is sometimes possible for the material contained within the vial of "SERPING1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.