Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPIND1 cdna clone

SERPIND1 cDNA Clone

Gene Names
SERPIND1; HC2; LS2; HCF2; HCII; HLS2; THPH10; D22S673
Synonyms
SERPIND1; SERPIND1 cDNA Clone; SERPIND1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaacactcattaaacgcacttctcattttcctcatcataacatctgcgtggggtgggagcaaaggcccgctggatcagctagagaaaggaggggaaactgctcagtctgcagatccccagtgggagcagttaaataacaaaaacctgagcatgcctcttctccctgccgacttccacaaggaaaacaccgtcaccaacgactggattccagagggggaggaggacgacgactatctggacctggagaagatattcagtgaagacgacgactacatcgacatcgtcgacagtctgtcagtttccccgacagactctgatgtgagtgctgggaacatcctccagctttttcatggcaagagccggatccagcgtcttaacatcgtcaacgccaagttcgctttcaacctctaccgagtgctgaaagaccaggtcaacactttcgataacatcttcatagcacccgttggcatttctactgcgatgggtatgatttccttaggtctgaagggagagacccatgaacaagtgcactcgattttgcattttaaagactttgttaatgccagcagcaagtatgaaatcacgaccattcataatctcttccgtaagctgactcatcgcctcttcaggaggaattttgggtacacactgcggtcagtcaatgacctttatatccagaagcagtttccaatcctgcttgacttcaaaactaaagtaagagagtattactttgctgaggcccagatagctgacttctcagaccctgccttcatatcaaaaaccaacaaccacatcatgaagctcaccaagggcctcataaaagatgctctggagaatatagaccctgctacccagatgatgattctcaactgcatctacttcaaaggatcctgggtgaataaattcccagtggaaatgacacacaaccacaacttccggctgaatgagagagaggtagttaaggtttccatgatgcagaccaaggggaacttcctcgcagcaaatgaccaggagctggactgcgacatcctccagctggaatacgtggggggcatcagcatgctaattgtggtcccacacaagatgtctgggatgaagaccctcgaagcgcaactgacacccggggtggtggagagatggcaaaaaagcatgacaaacagaactcgagaagtgcttctgccgaaattcaagctggagaagaactacaatctagtggagtccctgaagttgatggggatcaggatgctgtttgacaaaaatggcaacatggcaggcatctcagaccaaaggatcgccatcgacctgttcaagcaccaaggcacgatcacagtgaacgaggaaggcacccaagccaccactgtgaccacggtggggttcatgccgctgtccacccaagtccgcttcactgtcgaccgcccctttcttttcctcatctacgagcaccgcaccagctgcctgctcttcatgggaagagtggccaaccccagcaggtcctag
Sequence Length
1500
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,071 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade D (heparin cofactor), member 1, mRNA
NCBI Official Synonym Full Names
serpin family D member 1
NCBI Official Symbol
SERPIND1
NCBI Official Synonym Symbols
HC2; LS2; HCF2; HCII; HLS2; THPH10; D22S673
NCBI Protein Information
heparin cofactor 2
UniProt Protein Name
Heparin cofactor 2
Protein Family
UniProt Gene Name
SERPIND1
UniProt Synonym Gene Names
HCF2; HC-II; HLS2
UniProt Entry Name
HEP2_HUMAN

NCBI Description

This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2015]

Uniprot Description

SERPIND1: Thrombin inhibitor activated by the glycosaminoglycans, heparin or dermatan sulfate. In the presence of the latter, HC-II becomes the predominant thrombin inhibitor in place of antithrombin III (AT-III). Also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner. Defects in SERPIND1 are the cause of thrombophilia due to heparin cofactor 2 deficiency (THPH10). A hemostatic disorder characterized by a tendency to recurrent thrombosis. Belongs to the serpin family.

Chromosomal Location of Human Ortholog: 22q11.21

Cellular Component: extracellular region; extracellular space

Molecular Function: endopeptidase inhibitor activity; serine-type endopeptidase inhibitor activity

Biological Process: blood coagulation

Disease: Heparin Cofactor Ii Deficiency

Research Articles on SERPIND1

Similar Products

Product Notes

The SERPIND1 serpind1 (Catalog #AAA1271652) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacact cattaaacgc acttctcatt ttcctcatca taacatctgc gtggggtggg agcaaaggcc cgctggatca gctagagaaa ggaggggaaa ctgctcagtc tgcagatccc cagtgggagc agttaaataa caaaaacctg agcatgcctc ttctccctgc cgacttccac aaggaaaaca ccgtcaccaa cgactggatt ccagaggggg aggaggacga cgactatctg gacctggaga agatattcag tgaagacgac gactacatcg acatcgtcga cagtctgtca gtttccccga cagactctga tgtgagtgct gggaacatcc tccagctttt tcatggcaag agccggatcc agcgtcttaa catcgtcaac gccaagttcg ctttcaacct ctaccgagtg ctgaaagacc aggtcaacac tttcgataac atcttcatag cacccgttgg catttctact gcgatgggta tgatttcctt aggtctgaag ggagagaccc atgaacaagt gcactcgatt ttgcatttta aagactttgt taatgccagc agcaagtatg aaatcacgac cattcataat ctcttccgta agctgactca tcgcctcttc aggaggaatt ttgggtacac actgcggtca gtcaatgacc tttatatcca gaagcagttt ccaatcctgc ttgacttcaa aactaaagta agagagtatt actttgctga ggcccagata gctgacttct cagaccctgc cttcatatca aaaaccaaca accacatcat gaagctcacc aagggcctca taaaagatgc tctggagaat atagaccctg ctacccagat gatgattctc aactgcatct acttcaaagg atcctgggtg aataaattcc cagtggaaat gacacacaac cacaacttcc ggctgaatga gagagaggta gttaaggttt ccatgatgca gaccaagggg aacttcctcg cagcaaatga ccaggagctg gactgcgaca tcctccagct ggaatacgtg gggggcatca gcatgctaat tgtggtccca cacaagatgt ctgggatgaa gaccctcgaa gcgcaactga cacccggggt ggtggagaga tggcaaaaaa gcatgacaaa cagaactcga gaagtgcttc tgccgaaatt caagctggag aagaactaca atctagtgga gtccctgaag ttgatgggga tcaggatgct gtttgacaaa aatggcaaca tggcaggcat ctcagaccaa aggatcgcca tcgacctgtt caagcaccaa ggcacgatca cagtgaacga ggaaggcacc caagccacca ctgtgaccac ggtggggttc atgccgctgt ccacccaagt ccgcttcact gtcgaccgcc cctttctttt cctcatctac gagcaccgca ccagctgcct gctcttcatg ggaagagtgg ccaaccccag caggtcctag. It is sometimes possible for the material contained within the vial of "SERPIND1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.