Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINB9 cdna clone

SERPINB9 cDNA Clone

Gene Names
SERPINB9; PI9; CAP3; PI-9; CAP-3
Synonyms
SERPINB9; SERPINB9 cDNA Clone; SERPINB9 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaactctttctaatgcaagtggtacttttgccatacgccttttaaagatactgtgtcaagataacccttcgcacaacgtgttctgttctcctgtgagcatctcctctgccctggccatggttctcctaggggcaaagggaaacaccgcaacccagatggcccaggcactgtctttaaacacagaggaagacattcatcgggctttccagtcgcttctcactgaagtgaacaaggctggcacacagtacctgctgagaacggccaacaggctctttggagagaaaacttgtcagttcctctcaacgtttaaggaatcctgtcttcaattctaccatgctgagctgaaggagctttcctttatcagagctgcagaagagtccaggaaacacatcaacacctgggtctcaaaaaagaccgaaggtaaaattgaagagttgttgccgggtagctcaattgatgcagaaaccaggctggttcttgtcaatgccatctacttcaaaggaaagtggaatgaaccgtttgacgaaacatacacaagggaaatgccctttaaaataaaccaggaggagcaaaggccagtgcagatgatgtatcaggaggccacgtttaagctcgcccacgtgggcgaggtgcgcgcgcagctgctggagctgccctacgccaggaaggagctgagcctgctggtgctgctgcctgacgacggcgtggagctcagcacggtggaaaaaagtctcacttttgagaaactcacagcctggaccaagccagactgtatgaagagtactgaggttgaagttctccttccaaaatttaaactacaagaggattatgacatggaatctgtgcttcggcatttgggaattgttgatgccttccaacagggcaaggctgacttgtcggcaatgtcagcggagagagacctgtgtctgtccaagttcgtgcacaagagttttgtggaggtgaatgaagaaggcaccgaggcagcggcagcgtcgagctgctttgtagttgcagagtgctgcatggaatctggccccaggttctgtgctgaccaccctttccttttcttcatcaggcacaacagagccaacagcattctgttctgtggcaggttctcatcgccataa
Sequence Length
1131
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,404 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 9, mRNA
NCBI Official Synonym Full Names
serpin family B member 9
NCBI Official Symbol
SERPINB9
NCBI Official Synonym Symbols
PI9; CAP3; PI-9; CAP-3
NCBI Protein Information
serpin B9
UniProt Protein Name
Serpin B9
Protein Family
UniProt Gene Name
SERPINB9
UniProt Synonym Gene Names
PI9; CAP-3; CAP3; PI-9
UniProt Entry Name
SPB9_HUMAN

NCBI Description

This gene encodes a member of the serine protease inhibitor family which are also known as serpins. The encoded protein belongs to a subfamily of intracellular serpins. This protein inhibits the activity of the effector molecule granzyme B. Overexpression of this protein may prevent cytotoxic T-lymphocytes from eliminating certain tumor cells. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2012]

Uniprot Description

SERPINB9: Granzyme B inhibitor. Belongs to the serpin family. Ov-serpin subfamily.

Chromosomal Location of Human Ortholog: 6p25

Cellular Component: cytoplasm; cytosol; extracellular space; intracellular; membrane; nucleus

Molecular Function: caspase inhibitor activity; protease binding; protein binding; serine-type endopeptidase inhibitor activity

Biological Process: immune response; mast cell mediated immunity; negative regulation by symbiont of host apoptosis; negative regulation of apoptosis; protection from natural killer cell mediated cytotoxicity; response to bacterium

Research Articles on SERPINB9

Similar Products

Product Notes

The SERPINB9 serpinb9 (Catalog #AAA1269826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaactc tttctaatgc aagtggtact tttgccatac gccttttaaa gatactgtgt caagataacc cttcgcacaa cgtgttctgt tctcctgtga gcatctcctc tgccctggcc atggttctcc taggggcaaa gggaaacacc gcaacccaga tggcccaggc actgtcttta aacacagagg aagacattca tcgggctttc cagtcgcttc tcactgaagt gaacaaggct ggcacacagt acctgctgag aacggccaac aggctctttg gagagaaaac ttgtcagttc ctctcaacgt ttaaggaatc ctgtcttcaa ttctaccatg ctgagctgaa ggagctttcc tttatcagag ctgcagaaga gtccaggaaa cacatcaaca cctgggtctc aaaaaagacc gaaggtaaaa ttgaagagtt gttgccgggt agctcaattg atgcagaaac caggctggtt cttgtcaatg ccatctactt caaaggaaag tggaatgaac cgtttgacga aacatacaca agggaaatgc cctttaaaat aaaccaggag gagcaaaggc cagtgcagat gatgtatcag gaggccacgt ttaagctcgc ccacgtgggc gaggtgcgcg cgcagctgct ggagctgccc tacgccagga aggagctgag cctgctggtg ctgctgcctg acgacggcgt ggagctcagc acggtggaaa aaagtctcac ttttgagaaa ctcacagcct ggaccaagcc agactgtatg aagagtactg aggttgaagt tctccttcca aaatttaaac tacaagagga ttatgacatg gaatctgtgc ttcggcattt gggaattgtt gatgccttcc aacagggcaa ggctgacttg tcggcaatgt cagcggagag agacctgtgt ctgtccaagt tcgtgcacaa gagttttgtg gaggtgaatg aagaaggcac cgaggcagcg gcagcgtcga gctgctttgt agttgcagag tgctgcatgg aatctggccc caggttctgt gctgaccacc ctttcctttt cttcatcagg cacaacagag ccaacagcat tctgttctgt ggcaggttct catcgccata a. It is sometimes possible for the material contained within the vial of "SERPINB9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.