Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA3 cdna clone

SERPINA3 cDNA Clone

Gene Names
SERPINA3; ACT; AACT; GIG24; GIG25
Synonyms
SERPINA3; SERPINA3 cDNA Clone; SERPINA3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagagaatgttacctctcctggctctggggctcttggcggctgggttctgccctgctgtcctctgccaccctaacagcccacttgacgaggagaatctgacccaggagaaccaagaccgagggacacacgtggacctcggattagcctccgccaacgtggacttcgctttcagcctgtacaagcagttagtcctgaaggcccctgataagaatgtcatcttctccccactgagcatctccaccgccttggccttcctgtctctgggggcccataataccaccctgacagagattctcaaaggcctcaagttcaacctcacggagacttctgaggcagaaattcaccagagcttccagcacctcctgcgcaccctcaatcagtccagcgatgagctgcagctgagtatgggaaatgccatgtttgtcaaagagcaactcagtctgctggacaggttcacggaggatgccaagaggctgtatggctccgaggcctttgccactgactttcaggactcagctgcagctaagaagctcatcaacgactacgtgaagaatggaactagggggaaaatcacagatctgatcaaggaccttgactcgcagacaatgatggtcctggtgaattacatcttctttaaagccaaatgggagatgccctttgacccccaagatactcatcagtcaaggttctacttgagcaagaaaaagtgggtaatggtgcccatgatgagtttgcatcacctgactataccttacttccgggacgaggagctgtcctgcaccgtggtggagctgaggtacacaggcaatgccagcgcactcttcatcctccctgatcaagacaagatggaggaagtggaagccatgctgctcccagagaccctgaagcggtggagagactctctggagttcagagagataggtgagctctacctgccaaagttttccatctcgagggactataacctgaacgacatacttctccagctgggcattgaggaagccttcaccagcaaggctgacctgtcagggatcacaggggccaggaacctagcagtctcccaggtggtccataaggctgtgcttgatgtatttgaggagggcacagaagcatctgctgccacagcagtcaaaatcaccctcctttctgcattagtggagacaaggaccattgtgcgtttcaacaggcccttcctgatgatcattgtccctacagacacccagaacatcttcttcatgagcaaagtcaccaatcccaagcaagcctag
Sequence Length
1272
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
12
Molecular Weight
10,717 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3, mRNA
NCBI Official Synonym Full Names
serpin family A member 3
NCBI Official Symbol
SERPINA3
NCBI Official Synonym Symbols
ACT; AACT; GIG24; GIG25
NCBI Protein Information
alpha-1-antichymotrypsin
UniProt Protein Name
Alpha-1-antichymotrypsin
Protein Family
UniProt Gene Name
SERPINA3
UniProt Synonym Gene Names
AACT; ACT
UniProt Entry Name
AACT_HUMAN

NCBI Description

The protein encoded by this gene is a plasma protease inhibitor and member of the serine protease inhibitor class. Polymorphisms in this protein appear to be tissue specific and influence protease targeting. Variations in this protein's sequence have been implicated in Alzheimer's disease, and deficiency of this protein has been associated with liver disease. Mutations have been identified in patients with Parkinson disease and chronic obstructive pulmonary disease. [provided by RefSeq, Jul 2008]

Uniprot Description

SERPINA3: Although its physiological function is unclear, it can inhibit neutrophil cathepsin G and mast cell chymase, both of which can convert angiotensin-1 to the active angiotensin-2. Belongs to the serpin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q32.1

Cellular Component: extracellular region; extracellular space; nucleus

Molecular Function: DNA binding; protein binding; serine-type endopeptidase inhibitor activity

Biological Process: platelet degranulation

Research Articles on SERPINA3

Similar Products

Product Notes

The SERPINA3 serpina3 (Catalog #AAA1269148) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagaa tgttacctct cctggctctg gggctcttgg cggctgggtt ctgccctgct gtcctctgcc accctaacag cccacttgac gaggagaatc tgacccagga gaaccaagac cgagggacac acgtggacct cggattagcc tccgccaacg tggacttcgc tttcagcctg tacaagcagt tagtcctgaa ggcccctgat aagaatgtca tcttctcccc actgagcatc tccaccgcct tggccttcct gtctctgggg gcccataata ccaccctgac agagattctc aaaggcctca agttcaacct cacggagact tctgaggcag aaattcacca gagcttccag cacctcctgc gcaccctcaa tcagtccagc gatgagctgc agctgagtat gggaaatgcc atgtttgtca aagagcaact cagtctgctg gacaggttca cggaggatgc caagaggctg tatggctccg aggcctttgc cactgacttt caggactcag ctgcagctaa gaagctcatc aacgactacg tgaagaatgg aactaggggg aaaatcacag atctgatcaa ggaccttgac tcgcagacaa tgatggtcct ggtgaattac atcttcttta aagccaaatg ggagatgccc tttgaccccc aagatactca tcagtcaagg ttctacttga gcaagaaaaa gtgggtaatg gtgcccatga tgagtttgca tcacctgact ataccttact tccgggacga ggagctgtcc tgcaccgtgg tggagctgag gtacacaggc aatgccagcg cactcttcat cctccctgat caagacaaga tggaggaagt ggaagccatg ctgctcccag agaccctgaa gcggtggaga gactctctgg agttcagaga gataggtgag ctctacctgc caaagttttc catctcgagg gactataacc tgaacgacat acttctccag ctgggcattg aggaagcctt caccagcaag gctgacctgt cagggatcac aggggccagg aacctagcag tctcccaggt ggtccataag gctgtgcttg atgtatttga ggagggcaca gaagcatctg ctgccacagc agtcaaaatc accctccttt ctgcattagt ggagacaagg accattgtgc gtttcaacag gcccttcctg atgatcattg tccctacaga cacccagaac atcttcttca tgagcaaagt caccaatccc aagcaagcct ag. It is sometimes possible for the material contained within the vial of "SERPINA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.