Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEMA4B cdna clone

SEMA4B cDNA Clone

Gene Names
SEMA4B; SemC; SEMAC
Synonyms
SEMA4B; SEMA4B cDNA Clone; SEMA4B cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcgcaccgcgatgggcctgaggagctggctcgccgccccatggggcgcgctgccgcctcggccaccgctgctgctgctcctgctgctgctgctcctgctgcagccgccgcctccgacctgggcgctcagcccccggatcagcctgcctctgggctctgaagagcggccattcctcagattcgaagctgaacacatctccaactacacagcccttctgctgagcagggatggcaggaccctgtacgtgggtgctcgagaggccctctttgcactcagtagcaacctcagcttcctgccaggcggggagtaccaggagctgctttggggtgcagacgcagagaagaaacagcagtgcagcttcaagggcaaggacccacagcgcgactgtcaaaactacatcaagatcctcctgccgctcagcggcagtcacctgttcacctgtggcacagcagccttcagccccatgtgtacctacatcaacatggagaacttcaccctggcaagggacgagaaggggaatgtcctcctggaagatggcaagggccgttgtcccttcgacccgaatttcaagtccactgccctggtggttgatggcgagctctacactggaacagtcagcagcttccaagggaatgacccggccatctcgcggagccaaagccttcgccccaccaagaccgagagctccctcaactggctgcaagacccagcttttgtggcctcagcctacattcctgagagcctgggcagcttgcaaggcgatgatgacaagatctactttttcttcagcgagactggccaggaatttgagttctttgagaacaccattgtgtcccgcattgcccgcatctgcaagggcgatgagggtggagagcgggtgctacagcagcgctggacctccttcctcaaggcccagctgctgtgctcacggcccgacgatggcttccccttcaacgtgctgcaggatgtcttcacgctgagccccagcccccaggactggcgtgacacccttttctatggggtcttcacttcccagtggcacaggggaactacagaaggctctgccgtctgtgtcttcacaatgaaggatgtgcagagagtcttcagcggcctctacaaggaggtgaaccgtgagacacagcagtggtacaccgtgacccacccggtgcccacaccccggcctggagcgtgcatcaccaacagtgcccgggaaaggaagatcaactcatccctgcagctcccagaccgcgtgctgaacttcctcaaggaccacttcctgatggacgggcaggtccgaagccgcatgctgctgctgcagccccaggctcgctaccagcgcgtggctgtacaccgcgtccctggcctgcaccacacctacgatgtcctcttcctgggcactggtgacggccggctccacaaggcagtgagcgtgggcccccgggtgcacatcattgaggagctgcagatcttctcatcgggacagcccgtgcagaatctgctcctggacacccacagggggctgctgtatgcggcctcacactcgggcgtagtccaggtgcccatggccaactgcagcctgtaccggagctgtggggactgcctcctcgcccgggacccctactgtgcttggagcggctccagctgcaagcacgtcagcctctaccagcctcagctggccaccaggccgtggatccaggacatcgagggagccagcgccaaggacctttgcagcgcgtcttcggttgtgtccccgtcttttgtaccaacaggggagaagccatgtgagcaagtccagttccagcccaacacagtgaacactttggcctgcccgctcctctccaacctggcgacccgactctggctacgcaacggggcccccgtcaatgcctcggcctcctgccacgtgctacccactggggacctgctgctggtgggcacccaacagctgggggagttccagtgctggtcactagaggagggcttccagcagctggtagccagctactgcccagaggtggtggaggacggggtggcagaccaaacagatgagggtggcagtgtacccgtcattatcagcacatcgcgtgtgagtgcaccagctggtggcaaggccagctggggtgcagacaggtcctactggaaggagttcctggtgatgtgcacgctctttgtgctagccgtgctgctcccagttttattcttgctctaccggcaccggaacagcatgaaagtcttcctgaagcagggggaatgtgccagcgtgcaccccaagacctgccctgtggtgctgccccctgagacccgcccactcaacggcctagggccccctagcaccccgctcgatcaccgagggtaccagtccctgtcagacagccccccgggggcccgagtcttcactgagtcagagaagaggccactcagcatccaagacagcttcgtggaggtatccccagtgtgcccccggccccgggtccgccttggctcggagatccgtgactctgtggtgtga
Sequence Length
2514
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,403 Da
NCBI Official Full Name
Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B, mRNA
NCBI Official Synonym Full Names
semaphorin 4B
NCBI Official Symbol
SEMA4B
NCBI Official Synonym Symbols
SemC; SEMAC
NCBI Protein Information
semaphorin-4B
UniProt Protein Name
Semaphorin-4B
Protein Family
UniProt Gene Name
SEMA4B
UniProt Synonym Gene Names
KIAA1745; SEMAC
UniProt Entry Name
SEM4B_HUMAN

Uniprot Description

SEMA4B iso3: a single-pass type I membrane protein that inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Two alternatively spliced human isoforms have been described.

Protein type: Cell surface; Membrane protein, integral

Chromosomal Location of Human Ortholog: 15q25

Cellular Component: extracellular space; plasma membrane

Molecular Function: chemorepellent activity; semaphorin receptor binding

Biological Process: negative chemotaxis; negative regulation of axon extension involved in axon guidance; neural crest cell migration; positive regulation of cell migration

Research Articles on SEMA4B

Similar Products

Product Notes

The SEMA4B sema4b (Catalog #AAA1271785) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcgca ccgcgatggg cctgaggagc tggctcgccg ccccatgggg cgcgctgccg cctcggccac cgctgctgct gctcctgctg ctgctgctcc tgctgcagcc gccgcctccg acctgggcgc tcagcccccg gatcagcctg cctctgggct ctgaagagcg gccattcctc agattcgaag ctgaacacat ctccaactac acagcccttc tgctgagcag ggatggcagg accctgtacg tgggtgctcg agaggccctc tttgcactca gtagcaacct cagcttcctg ccaggcgggg agtaccagga gctgctttgg ggtgcagacg cagagaagaa acagcagtgc agcttcaagg gcaaggaccc acagcgcgac tgtcaaaact acatcaagat cctcctgccg ctcagcggca gtcacctgtt cacctgtggc acagcagcct tcagccccat gtgtacctac atcaacatgg agaacttcac cctggcaagg gacgagaagg ggaatgtcct cctggaagat ggcaagggcc gttgtccctt cgacccgaat ttcaagtcca ctgccctggt ggttgatggc gagctctaca ctggaacagt cagcagcttc caagggaatg acccggccat ctcgcggagc caaagccttc gccccaccaa gaccgagagc tccctcaact ggctgcaaga cccagctttt gtggcctcag cctacattcc tgagagcctg ggcagcttgc aaggcgatga tgacaagatc tactttttct tcagcgagac tggccaggaa tttgagttct ttgagaacac cattgtgtcc cgcattgccc gcatctgcaa gggcgatgag ggtggagagc gggtgctaca gcagcgctgg acctccttcc tcaaggccca gctgctgtgc tcacggcccg acgatggctt ccccttcaac gtgctgcagg atgtcttcac gctgagcccc agcccccagg actggcgtga cacccttttc tatggggtct tcacttccca gtggcacagg ggaactacag aaggctctgc cgtctgtgtc ttcacaatga aggatgtgca gagagtcttc agcggcctct acaaggaggt gaaccgtgag acacagcagt ggtacaccgt gacccacccg gtgcccacac cccggcctgg agcgtgcatc accaacagtg cccgggaaag gaagatcaac tcatccctgc agctcccaga ccgcgtgctg aacttcctca aggaccactt cctgatggac gggcaggtcc gaagccgcat gctgctgctg cagccccagg ctcgctacca gcgcgtggct gtacaccgcg tccctggcct gcaccacacc tacgatgtcc tcttcctggg cactggtgac ggccggctcc acaaggcagt gagcgtgggc ccccgggtgc acatcattga ggagctgcag atcttctcat cgggacagcc cgtgcagaat ctgctcctgg acacccacag ggggctgctg tatgcggcct cacactcggg cgtagtccag gtgcccatgg ccaactgcag cctgtaccgg agctgtgggg actgcctcct cgcccgggac ccctactgtg cttggagcgg ctccagctgc aagcacgtca gcctctacca gcctcagctg gccaccaggc cgtggatcca ggacatcgag ggagccagcg ccaaggacct ttgcagcgcg tcttcggttg tgtccccgtc ttttgtacca acaggggaga agccatgtga gcaagtccag ttccagccca acacagtgaa cactttggcc tgcccgctcc tctccaacct ggcgacccga ctctggctac gcaacggggc ccccgtcaat gcctcggcct cctgccacgt gctacccact ggggacctgc tgctggtggg cacccaacag ctgggggagt tccagtgctg gtcactagag gagggcttcc agcagctggt agccagctac tgcccagagg tggtggagga cggggtggca gaccaaacag atgagggtgg cagtgtaccc gtcattatca gcacatcgcg tgtgagtgca ccagctggtg gcaaggccag ctggggtgca gacaggtcct actggaagga gttcctggtg atgtgcacgc tctttgtgct agccgtgctg ctcccagttt tattcttgct ctaccggcac cggaacagca tgaaagtctt cctgaagcag ggggaatgtg ccagcgtgca ccccaagacc tgccctgtgg tgctgccccc tgagacccgc ccactcaacg gcctagggcc ccctagcacc ccgctcgatc accgagggta ccagtccctg tcagacagcc ccccgggggc ccgagtcttc actgagtcag agaagaggcc actcagcatc caagacagct tcgtggaggt atccccagtg tgcccccggc cccgggtccg ccttggctcg gagatccgtg actctgtggt gtga. It is sometimes possible for the material contained within the vial of "SEMA4B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.