Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEMA4A cdna clone

SEMA4A cDNA Clone

Gene Names
SEMA4A; RP35; SEMB; SEMAB; CORD10
Synonyms
SEMA4A; SEMA4A cDNA Clone; SEMA4A cdna clone
Ordering
For Research Use Only!
Sequence
atggccctcccagccctgggcctggacccctggagcctcctgggccttttcctcttccaactgcttcagctgctgctgccgacgacgaccgcggggggaggcgggcaggggcccatgcccagggtcagatactatgcaggggatgaacgtagggcacttagcttcttccaccagaagggcctccaggattttgacactctgctcctgagtggtgatggaaatactctctacgtgggggctcgagaagccattctggccttggatatccaggatccaggggtccccaggctaaagaacatgataccgtggccagccagtgacagaaaaaagagtgaatgtgcctttaagaagaagagcaatgagacacagtgtttcaacttcatccgtgtcctggtttcttacaatgtcacccatctctacacctgcggcaccttcgccttcagccctgcttgtaccttcattgaacttcaagattcctacctgttgcccatctcggaggacaaggtcatggagggaaaaggccaaagcccctttgaccccgctcacaagcatacggctgtcttggtggatgggatgctctattctggtactatgaacaacttcctgggcagtgagcccatcctgatgcgcacactgggatcccagcctgtcctcaagaccgacaacttcctccgctggctgcatcatgacgcctcctttgtggcagccatcccttcgacccaggtcgtctacttcttcttcgaggagacagccagcgagtttgacttctttgagaggctccacacatcgcgggtggctagagtctgcaagaatgacgtgggcggcgaaaagctgctgcagaagaagtggaccaccttcctgaaggcccagctgctctgcacccagccggggcagctgcccttcaacgtcatccgccacgcggtcctgctccccgccgattctcccacagctccccacatctacgcagtcttcacctcccagtggcaggttggcgggaccaggagctctgcggtttgtgccttctctctcttggacattgaacgtgtctttaaggggaaatacaaagagttgaacaaagaaacttcacgctggactacttataggggccctgagaccaacccccggccaggcagttgctcagtgggcccctcctctgataaggccctgaccttcatgaaggaccatttcctgatggatgagcaagtggtggggacgcccctgctggtgaaatctggcgtggagtatacacggcttgcagtggagacagcccagggccttgatgggcacagccatcttgtcatgtacctgggaaccaccacagggtcgctccacaaggctgtggtaagtggggacagcagtgctcatctggtggaagagattcagctgttccctgaccctgaacctgttcgcaacctgcagctggcccccacccagggtgcagtgtttgtaggcttctcaggaggtgtctggagggtgccccgagccaactgtagtgtctatgagagctgtgtggactgtgtccttgcccgggacccccactgtgcctgggaccctgagtcccgaacctgttgcctcctgtctgcccccaacctgaactcctggaagcaggacatggagcgggggaacccagagtgggcatgtgccagtggccccatgagcaggagccttcggcctcagagccgcccgcaaatcattaaagaagtcctggctgtccctaactccatcctggagctcccctgcccccacctgtcagccttggcctcttattattggagtcatggcccagcagcagtcccagaagcctcttccactgtctacaatggctccctcttgctgatagtgcaggatggagttgggggtctctaccagtgctgggcaactgagaatggcttttcataccctgtgatctcctactgggtggacagccaggaccagaccctggccctggatcctgaactggcaggcatcccccgggagcatgtgaaggtcccgttgaccagggtcagtggtggggccgccctggctgcccagcagtcctactggccccactttgtcactgtcactgtcctctttgccttagtgctttcaggagccctcatcatcctcgtggcctccccattgagagcactccgggctcggggcaaggttcagggctgtgagaccctgcgccctggggagaaggccccgttaagcagagagcaacacctccagtctcccaaggaatgcaggacctctgccagtgatgtggacgctgacaacaactgcctaggcactgaggtagcttaa
Sequence Length
2286
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,104 Da
NCBI Official Full Name
Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A, mRNA
NCBI Official Synonym Full Names
semaphorin 4A
NCBI Official Symbol
SEMA4A
NCBI Official Synonym Symbols
RP35; SEMB; SEMAB; CORD10
NCBI Protein Information
semaphorin-4A
UniProt Protein Name
Semaphorin-4A
Protein Family
UniProt Gene Name
SEMA4A
UniProt Synonym Gene Names
SEMAB; SEMB; Sema B
UniProt Entry Name
SEM4A_HUMAN

NCBI Description

This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]

Uniprot Description

SEMA4A: a single-pass type I membrane protein that inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Defects in SEMA4A are the cause of retinitis pigmentosa type 35 and cone-rod dystrophy type 10.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q22

Cellular Component: extracellular space; plasma membrane

Molecular Function: chemorepellent activity; protein binding; semaphorin receptor binding

Biological Process: negative chemotaxis; negative regulation of axon extension involved in axon guidance; neural crest cell migration; positive regulation of cell migration

Disease: Cone-rod Dystrophy 10; Retinitis Pigmentosa 35

Research Articles on SEMA4A

Similar Products

Product Notes

The SEMA4A sema4a (Catalog #AAA1268252) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctcc cagccctggg cctggacccc tggagcctcc tgggcctttt cctcttccaa ctgcttcagc tgctgctgcc gacgacgacc gcggggggag gcgggcaggg gcccatgccc agggtcagat actatgcagg ggatgaacgt agggcactta gcttcttcca ccagaagggc ctccaggatt ttgacactct gctcctgagt ggtgatggaa atactctcta cgtgggggct cgagaagcca ttctggcctt ggatatccag gatccagggg tccccaggct aaagaacatg ataccgtggc cagccagtga cagaaaaaag agtgaatgtg cctttaagaa gaagagcaat gagacacagt gtttcaactt catccgtgtc ctggtttctt acaatgtcac ccatctctac acctgcggca ccttcgcctt cagccctgct tgtaccttca ttgaacttca agattcctac ctgttgccca tctcggagga caaggtcatg gagggaaaag gccaaagccc ctttgacccc gctcacaagc atacggctgt cttggtggat gggatgctct attctggtac tatgaacaac ttcctgggca gtgagcccat cctgatgcgc acactgggat cccagcctgt cctcaagacc gacaacttcc tccgctggct gcatcatgac gcctcctttg tggcagccat cccttcgacc caggtcgtct acttcttctt cgaggagaca gccagcgagt ttgacttctt tgagaggctc cacacatcgc gggtggctag agtctgcaag aatgacgtgg gcggcgaaaa gctgctgcag aagaagtgga ccaccttcct gaaggcccag ctgctctgca cccagccggg gcagctgccc ttcaacgtca tccgccacgc ggtcctgctc cccgccgatt ctcccacagc tccccacatc tacgcagtct tcacctccca gtggcaggtt ggcgggacca ggagctctgc ggtttgtgcc ttctctctct tggacattga acgtgtcttt aaggggaaat acaaagagtt gaacaaagaa acttcacgct ggactactta taggggccct gagaccaacc cccggccagg cagttgctca gtgggcccct cctctgataa ggccctgacc ttcatgaagg accatttcct gatggatgag caagtggtgg ggacgcccct gctggtgaaa tctggcgtgg agtatacacg gcttgcagtg gagacagccc agggccttga tgggcacagc catcttgtca tgtacctggg aaccaccaca gggtcgctcc acaaggctgt ggtaagtggg gacagcagtg ctcatctggt ggaagagatt cagctgttcc ctgaccctga acctgttcgc aacctgcagc tggcccccac ccagggtgca gtgtttgtag gcttctcagg aggtgtctgg agggtgcccc gagccaactg tagtgtctat gagagctgtg tggactgtgt ccttgcccgg gacccccact gtgcctggga ccctgagtcc cgaacctgtt gcctcctgtc tgcccccaac ctgaactcct ggaagcagga catggagcgg gggaacccag agtgggcatg tgccagtggc cccatgagca ggagccttcg gcctcagagc cgcccgcaaa tcattaaaga agtcctggct gtccctaact ccatcctgga gctcccctgc ccccacctgt cagccttggc ctcttattat tggagtcatg gcccagcagc agtcccagaa gcctcttcca ctgtctacaa tggctccctc ttgctgatag tgcaggatgg agttgggggt ctctaccagt gctgggcaac tgagaatggc ttttcatacc ctgtgatctc ctactgggtg gacagccagg accagaccct ggccctggat cctgaactgg caggcatccc ccgggagcat gtgaaggtcc cgttgaccag ggtcagtggt ggggccgccc tggctgccca gcagtcctac tggccccact ttgtcactgt cactgtcctc tttgccttag tgctttcagg agccctcatc atcctcgtgg cctccccatt gagagcactc cgggctcggg gcaaggttca gggctgtgag accctgcgcc ctggggagaa ggccccgtta agcagagagc aacacctcca gtctcccaag gaatgcagga cctctgccag tgatgtggac gctgacaaca actgcctagg cactgaggta gcttaa. It is sometimes possible for the material contained within the vial of "SEMA4A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.