Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SELPLG cdna clone

SELPLG cDNA Clone

Gene Names
SELPLG; CLA; CD162; PSGL1; PSGL-1
Synonyms
SELPLG; SELPLG cDNA Clone; SELPLG cdna clone
Ordering
For Research Use Only!
Sequence
atgcctctgcaactcctcctgttgctgatcctactgggccctggcaacagcttgcagctgtgggacacctgggcagatgaagccgagaaagccttgggtcccctgcttgcccgggaccggagacaggccaccgaatatgagtacctagattatgatttcctgccagaaacggagcctccagaaatgctgaggaacagcactgacaccactcctctgactgggcctggaacccctgagtctaccactgtggagcctgctgcaaggcgttctactggcctggatgcaggaggggcagtcacagagctgaccacggagctggccaacatggggaacctgtccacggattcagcagctatggagatacagaccactcaaccagcagccacggaggcacagaccactccactggcagccacagaggcacagacaactcgactgacggccacggaggcacagaccactccactggcagccacagaggcacagaccactccaccagcagccacggaagcacagaccactcaacccacaggcctggaggcacagaccactgcaccagcagccatggaggcacagaccactgcaccagcagccatggaagcacagaccactccaccagcagccatggaggcacagaccactcaaaccacagccatggaggcacagaccactgcaccagaagccacggaggcacagaccactcaacccacagccacggaggcacagaccactccactggcagccatggaggccctgtccacagaacccagtgccacagaggccctgtccatggaacctactaccaaaagaggtctgttcatacccttttctgtgtcctctgttactcacaagggcattcccatggcagccagcaatttgtccgtcaactacccagtgggggccccagaccacatctctgtgaagcagtgcctgctggccatcctaatcttggcgctggtggccactatcttcttcgtgtgcactgtggtgctggcggtccgcctctcccgcaagggccacatgtaccccgtgcgtaattactcccccaccgagatggtctgcatctcatccctgttgcctgatgggggtgaggggccctctgccacagccaatgggggcctgtccaaggccaagagcccgggcctgacgccagagcccagggaggaccgtgagggggatgacctcaccctgcacagcttcctcccttag
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,648 Da
NCBI Official Full Name
Homo sapiens selectin P ligand, mRNA
NCBI Official Synonym Full Names
selectin P ligand
NCBI Official Symbol
SELPLG
NCBI Official Synonym Symbols
CLA; CD162; PSGL1; PSGL-1
NCBI Protein Information
P-selectin glycoprotein ligand 1
UniProt Protein Name
P-selectin glycoprotein ligand 1
UniProt Gene Name
SELPLG
UniProt Synonym Gene Names
PSGL-1
UniProt Entry Name
SELPL_HUMAN

NCBI Description

This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]

Uniprot Description

SELPLG: A SLe(x)-type glycan, which through high affinity, calcium-dependent interactions with E-, P- and L-selectins, mediates rapid rolling of leukocytes over vascular surfaces during the initial steps in inflammation. PSGL1 is critical for the initial leukocyte capture.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q24

Cellular Component: integral to membrane; integral to plasma membrane; membrane; plasma membrane; uropod

Molecular Function: protein binding

Biological Process: leukocyte adhesive activation; leukocyte migration

Research Articles on SELPLG

Similar Products

Product Notes

The SELPLG selplg (Catalog #AAA1278233) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctctgc aactcctcct gttgctgatc ctactgggcc ctggcaacag cttgcagctg tgggacacct gggcagatga agccgagaaa gccttgggtc ccctgcttgc ccgggaccgg agacaggcca ccgaatatga gtacctagat tatgatttcc tgccagaaac ggagcctcca gaaatgctga ggaacagcac tgacaccact cctctgactg ggcctggaac ccctgagtct accactgtgg agcctgctgc aaggcgttct actggcctgg atgcaggagg ggcagtcaca gagctgacca cggagctggc caacatgggg aacctgtcca cggattcagc agctatggag atacagacca ctcaaccagc agccacggag gcacagacca ctccactggc agccacagag gcacagacaa ctcgactgac ggccacggag gcacagacca ctccactggc agccacagag gcacagacca ctccaccagc agccacggaa gcacagacca ctcaacccac aggcctggag gcacagacca ctgcaccagc agccatggag gcacagacca ctgcaccagc agccatggaa gcacagacca ctccaccagc agccatggag gcacagacca ctcaaaccac agccatggag gcacagacca ctgcaccaga agccacggag gcacagacca ctcaacccac agccacggag gcacagacca ctccactggc agccatggag gccctgtcca cagaacccag tgccacagag gccctgtcca tggaacctac taccaaaaga ggtctgttca tacccttttc tgtgtcctct gttactcaca agggcattcc catggcagcc agcaatttgt ccgtcaacta cccagtgggg gccccagacc acatctctgt gaagcagtgc ctgctggcca tcctaatctt ggcgctggtg gccactatct tcttcgtgtg cactgtggtg ctggcggtcc gcctctcccg caagggccac atgtaccccg tgcgtaatta ctcccccacc gagatggtct gcatctcatc cctgttgcct gatgggggtg aggggccctc tgccacagcc aatgggggcc tgtccaaggc caagagcccg ggcctgacgc cagagcccag ggaggaccgt gagggggatg acctcaccct gcacagcttc ctcccttag. It is sometimes possible for the material contained within the vial of "SELPLG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.