Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCYL1 cdna clone

SCYL1 cDNA Clone

Gene Names
SCYL1; GKLP; NKTL; NTKL; P105; TAPK; TEIF; TRAP; HT019; SCAR21
Synonyms
SCYL1; SCYL1 cDNA Clone; SCYL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttctcatccactgaccgggccatgcgcatccgcctcctgcagcagatggagcagttcatccagtaccttgacgagccaacagtcaacacccagatcttcccccacgtcgtacatggcttcctggacaccaaccctgccatccgggagcagacggtcaagtccatgctgctcctggccccaaagctgaacgaggccaacctcaatgtggagctgatgaagcactttgcacggctacaggccaaggatgaacagggccccatccgctgcaacaccacagtctgcctgggcaaaatcggctcctacctcagtgctagcaccagacacagggtccttacctctgccttcagccgagccactagggacccgtttgcaccgtcccgggttgcgggtgtcctgggctttgctgccacccacaacctctactcaatgaacgactgtgcccagaagatcctgcctgtgctctgcggtctcactgtagatcctgagaaatccgtgcgagaccaggccttcaaggccattcggagcttcctgtccaaattggagtctgtgtcggaggacccgacccagctggaggaagtggagaaggatgtccatgcagcctccagccctggcatgggaggagccgcagctagctgggcaggctgggccgtgaccggggtctcctcactcacctccaagctgatccgttcgcacccaaccactgccccaacagaaaccaacattccccaaagacccacgcctgaaggagttcctgccccagcccccacccctgttcctgccacccctacaacctcaggccactgggagacgcaggaggaggacaaggacacagcagaggacagcagcactgctgacagatgggacgacgaagactggggcagcctggagcaggaggccgagtctgtgctggcccagcaggacgactggagcaccgggggccaagtgagccgtgctagtcaggtcagcaactccgaccacaaatcctccaaatccccagagtccgactggagcagctgggaagctgagggctcctgggaacagggctggcaggagccaagctcccaggagccacctcctgacggtacacggctggccagcgagtataactggggtggcccagagtccagcgacaagggcgaccccttcgctaccctgtctgcacgtcccagcacccaggacaggtcaaggctgagctggcccggaagaagcgcgaggagcggcggcgggagatggaggccaaacgcgccgagaggaaggtggccaagggccccatga
Sequence Length
1278
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,371 Da
NCBI Official Full Name
Homo sapiens SCY1-like 1 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SCY1 like pseudokinase 1
NCBI Official Symbol
SCYL1
NCBI Official Synonym Symbols
GKLP; NKTL; NTKL; P105; TAPK; TEIF; TRAP; HT019; SCAR21
NCBI Protein Information
N-terminal kinase-like protein
UniProt Protein Name
N-terminal kinase-like protein
UniProt Gene Name
SCYL1
UniProt Synonym Gene Names
CVAK90; GKLP; NTKL; TAPK; TEIF; TRAP
UniProt Entry Name
NTKL_HUMAN

NCBI Description

This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SCYL1: Regulates COPI-mediated retrograde traffic. Has no detectable kinase activity in vitro. Belongs to the protein kinase superfamily. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, Other; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Other group; SCY1 family

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cell-cell adherens junction; cis-Golgi network; COPI vesicle coat; cytoplasm; ER-Golgi intermediate compartment; Golgi apparatus; membrane

Biological Process: retrograde vesicle-mediated transport, Golgi to ER

Disease: Spinocerebellar Ataxia, Autosomal Recessive 21

Research Articles on SCYL1

Similar Products

Product Notes

The SCYL1 scyl1 (Catalog #AAA1267281) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttctcat ccactgaccg ggccatgcgc atccgcctcc tgcagcagat ggagcagttc atccagtacc ttgacgagcc aacagtcaac acccagatct tcccccacgt cgtacatggc ttcctggaca ccaaccctgc catccgggag cagacggtca agtccatgct gctcctggcc ccaaagctga acgaggccaa cctcaatgtg gagctgatga agcactttgc acggctacag gccaaggatg aacagggccc catccgctgc aacaccacag tctgcctggg caaaatcggc tcctacctca gtgctagcac cagacacagg gtccttacct ctgccttcag ccgagccact agggacccgt ttgcaccgtc ccgggttgcg ggtgtcctgg gctttgctgc cacccacaac ctctactcaa tgaacgactg tgcccagaag atcctgcctg tgctctgcgg tctcactgta gatcctgaga aatccgtgcg agaccaggcc ttcaaggcca ttcggagctt cctgtccaaa ttggagtctg tgtcggagga cccgacccag ctggaggaag tggagaagga tgtccatgca gcctccagcc ctggcatggg aggagccgca gctagctggg caggctgggc cgtgaccggg gtctcctcac tcacctccaa gctgatccgt tcgcacccaa ccactgcccc aacagaaacc aacattcccc aaagacccac gcctgaagga gttcctgccc cagcccccac ccctgttcct gccaccccta caacctcagg ccactgggag acgcaggagg aggacaagga cacagcagag gacagcagca ctgctgacag atgggacgac gaagactggg gcagcctgga gcaggaggcc gagtctgtgc tggcccagca ggacgactgg agcaccgggg gccaagtgag ccgtgctagt caggtcagca actccgacca caaatcctcc aaatccccag agtccgactg gagcagctgg gaagctgagg gctcctggga acagggctgg caggagccaa gctcccagga gccacctcct gacggtacac ggctggccag cgagtataac tggggtggcc cagagtccag cgacaagggc gaccccttcg ctaccctgtc tgcacgtccc agcacccagg acaggtcaag gctgagctgg cccggaagaa gcgcgaggag cggcggcggg agatggaggc caaacgcgcc gagaggaagg tggccaaggg ccccatga. It is sometimes possible for the material contained within the vial of "SCYL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.