SCML4 cdna clone
SCML4 cDNA Clone
Gene Names
SCML4; dJ47M23.1
Synonyms
SCML4; SCML4 cDNA Clone; SCML4 cdna clone
Sequence
atgccctgccagagaacagcttggataggttgcgacaggcagagaacccccccattccactggagagagatcaagtctcgggttctcatgactcccttagccctctcacctccgcggagtaccccagagcccgacctcagctccatccctcaggacgcagccacggtccccagcttggcggccccacaggctctcacagtctgcctctacatcaacaagcaggccaatgcggggccctatctggagaggaagaaggtgcagcagctcccggagcattttgggcccgagcggccatcggcggtgctgcagcaggccgtccaagcctgcatcgactgcgcccaccagcagaagctggtcttctccctggtcaagcagggctatggtggtgagatggtgtcagtctcggcttcctttgatggcaaacagcacctgcggagcctgcctgtggtgaacagcatcggctatgtcctccgcttcctcgccaagctgtgccgaagcctcctgtgcgatgacctcttcagccaccagcccttccccaggggctgcagtgcctctgagaaagtccaggagaaagaggaagggaggatggaatcagtcaagacagtcaccaccgaagagtacctggtgaaccctgtgggcatgaaccgctacagcgtggacacctccgcctccacctttaaccacaggggctccttgcacccctcctcctcgctgtactgcaagaggcagaactctggagacagccaccttgggggtggtcctgctgccaccgctggtggtccccgcactagccccatgtcttctggtggcccctcggcacctgggctgaggcctccagcctccagccccaagagaaacacgacctctcttgaaggaaacagatgtggtaatgtaatgcatgcatcagcttcccactga
Sequence Length
918
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,976 Da
NCBI Official Full Name
Homo sapiens sex comb on midleg-like 4 (Drosophila), mRNA
NCBI Official Synonym Full Names
sex comb on midleg-like 4 (Drosophila)
NCBI Official Symbol
SCML4
NCBI Official Synonym Symbols
dJ47M23.1
NCBI Protein Information
sex comb on midleg-like protein 4
UniProt Protein Name
Sex comb on midleg-like protein 4
Protein Family
UniProt Gene Name
SCML4
UniProt Entry Name
SCML4_HUMAN
Uniprot Description
SCML4: Putative Polycomb group (PcG) protein. PcG proteins act by forming multiprotein complexes, which are required to maintain the transcriptionally repressive state of homeotic genes throughout development. Belongs to the SCM family. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 6q21
Research Articles on SCML4
Similar Products
Product Notes
The SCML4 scml4 (Catalog #AAA1269388) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctgcc agagaacagc ttggataggt tgcgacaggc agagaacccc cccattccac tggagagaga tcaagtctcg ggttctcatg actcccttag ccctctcacc tccgcggagt accccagagc ccgacctcag ctccatccct caggacgcag ccacggtccc cagcttggcg gccccacagg ctctcacagt ctgcctctac atcaacaagc aggccaatgc ggggccctat ctggagagga agaaggtgca gcagctcccg gagcattttg ggcccgagcg gccatcggcg gtgctgcagc aggccgtcca agcctgcatc gactgcgccc accagcagaa gctggtcttc tccctggtca agcagggcta tggtggtgag atggtgtcag tctcggcttc ctttgatggc aaacagcacc tgcggagcct gcctgtggtg aacagcatcg gctatgtcct ccgcttcctc gccaagctgt gccgaagcct cctgtgcgat gacctcttca gccaccagcc cttccccagg ggctgcagtg cctctgagaa agtccaggag aaagaggaag ggaggatgga atcagtcaag acagtcacca ccgaagagta cctggtgaac cctgtgggca tgaaccgcta cagcgtggac acctccgcct ccacctttaa ccacaggggc tccttgcacc cctcctcctc gctgtactgc aagaggcaga actctggaga cagccacctt gggggtggtc ctgctgccac cgctggtggt ccccgcacta gccccatgtc ttctggtggc ccctcggcac ctgggctgag gcctccagcc tccagcccca agagaaacac gacctctctt gaaggaaaca gatgtggtaa tgtaatgcat gcatcagctt cccactga. It is sometimes possible for the material contained within the vial of "SCML4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
