Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

SCG5 cdna clone

SCG5 cDNA Clone

Gene Names
SCG5; 7B2; SgV; P7B2; SGNE1
Synonyms
SCG5; SCG5 cDNA Clone; SCG5 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggtctccaggatggtctctaccatgctatctggcctactgttttggctggcatctggatggactccagcatttgcttacagcccccggacccctgaccgggtctcagaagcagatatccagaggctgcttcatggtgttatggagcaattgggcattgccaggccccgagtggaatatccagctcaccaggccatgaatcttgtgggcccccagagcattgaaggtggagctcatgaaggacttcagcatttgggtccttttggcaacatccccaacatcgtggcagagttgactggagacaacattcctaaggactttagtgaggatcaggggtacccagaccctccaaatccctgtcctgttggaaaaacagcagatgatggatgtctagaaaacacccctgacactgcagagttcagtcgagagttccagttgcaccagcatctctctgatccggaacatgactatccaggcttgggcaagtggaacaagaaactcctttacgagaagatgaagggaggagagagacgaaagcggaggagtgtcaatccatatctacaaggacagagactggataatgttgttgcaaagaagtctgtcccccatttttcagatgaggataaggatccagagtaa
Sequence Length
639
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,659 Da
NCBI Official Full Name
Homo sapiens secretogranin V (7B2 protein), mRNA
NCBI Official Synonym Full Names
secretogranin V
NCBI Official Symbol
SCG5
NCBI Official Synonym Symbols
7B2; SgV; P7B2; SGNE1
NCBI Protein Information
neuroendocrine protein 7B2
UniProt Protein Name
Neuroendocrine protein 7B2
Protein Family
UniProt Gene Name
SCG5
UniProt Synonym Gene Names
SGNE1
UniProt Entry Name
7B2_HUMAN

NCBI Description

This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. [provided by RefSeq, Jul 2016]

Uniprot Description

7B2: Acts as a molecular chaperone for PCSK2/PC2, preventing its premature activation in the regulated secretory pathway. Binds to inactive PCSK2 in the endoplasmic reticulum and facilitates its transport from there to later compartments of the secretory pathway where it is proteolytically matured and activated. Also required for cleavage of PCSK2 but does not appear to be involved in its folding. Plays a role in regulating pituitary hormone secretion. The C-terminal peptide inhibits PCSK2 in vitro. Belongs to the 7B2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 15q13-q14

Cellular Component: secretory granule

Molecular Function: enzyme inhibitor activity; GTP binding; protein binding; unfolded protein binding

Biological Process: intracellular protein transport; peptide hormone processing; regulation of hormone secretion

Research Articles on SCG5

Similar Products

Product Notes

The SCG5 scg5 (Catalog #AAA1268745) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtctcca ggatggtctc taccatgcta tctggcctac tgttttggct ggcatctgga tggactccag catttgctta cagcccccgg acccctgacc gggtctcaga agcagatatc cagaggctgc ttcatggtgt tatggagcaa ttgggcattg ccaggccccg agtggaatat ccagctcacc aggccatgaa tcttgtgggc ccccagagca ttgaaggtgg agctcatgaa ggacttcagc atttgggtcc ttttggcaac atccccaaca tcgtggcaga gttgactgga gacaacattc ctaaggactt tagtgaggat caggggtacc cagaccctcc aaatccctgt cctgttggaa aaacagcaga tgatggatgt ctagaaaaca cccctgacac tgcagagttc agtcgagagt tccagttgca ccagcatctc tctgatccgg aacatgacta tccaggcttg ggcaagtgga acaagaaact cctttacgag aagatgaagg gaggagagag acgaaagcgg aggagtgtca atccatatct acaaggacag agactggata atgttgttgc aaagaagtct gtcccccatt tttcagatga ggataaggat ccagagtaa. It is sometimes possible for the material contained within the vial of "SCG5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual