Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCEL cdna clone

SCEL cDNA Clone

Synonyms
SCEL; SCEL cDNA Clone; SCEL cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaatgttaccttgagaaaaatgtctcccacaggaaatgagatgaagagcaccactcagggaaccacacggaagcagcaggattttcacgaggtgaacaaaagaagaactttcttacaggataacagttggataaagaaacgccctgaagaagaaaaagatgaaaattacggtagggtggtgctcaaccgacataattcccatgatgcattggacaggaaagtaaatgagagagatgtgccaaaagctacaattagtcggtacagttctgatgacactttggacaggagcatgtccatgtttagatcactggaagtaacaaagttgcaacctggcggttcattgaatgccaacacctccaacaccatagcatccacttctgctactactcctgtaaagaagaagaggcagtcctggtttccaccgccccctccaggttacaatgcctcttcgagcacaggaaccaggagacgggaaccaggtgttcaccctccaatacctccaaagcccagttctcctgtttcttctcctaaccagctgagacaggataataggcagatacatccacctaaaccaggtgtatatacagaaaccaacagatctgctgaaagaaatataagtgaagaattggataatctcatcaaaatgaacaaaagcttgaataggaatcaaggtcttgatagtctcttcagagcaaatccaaaggtagaagaaagagagaaaaaagccaaaagccttgaaagtctcatctatatgagtacccggacagataaagatggcaaaggaatccaaagccttggaagtccgattaaagttaatcaaaggactgacaaaaatgagaaagggtaa
Sequence Length
852
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,843 Da
NCBI Official Full Name
Homo sapiens sciellin, mRNA
NCBI Official Synonym Full Names
sciellin
NCBI Official Symbol
SCEL
NCBI Protein Information
sciellin
UniProt Protein Name
Sciellin
Protein Family
UniProt Gene Name
SCEL
UniProt Entry Name
SCEL_HUMAN

NCBI Description

The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

SCEL: May function in the assembly or regulation of proteins in the cornified envelope. The LIM domain may be involved in homotypic or heterotypic associations and may function to localize sciellin to the cornified envelope. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 13q22

Cellular Component: cornified envelope; cytoplasm

Molecular Function: protein binding

Biological Process: embryonic development; epidermis development; keratinocyte differentiation

Research Articles on SCEL

Similar Products

Product Notes

The SCEL scel (Catalog #AAA1276649) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaatg ttaccttgag aaaaatgtct cccacaggaa atgagatgaa gagcaccact cagggaacca cacggaagca gcaggatttt cacgaggtga acaaaagaag aactttctta caggataaca gttggataaa gaaacgccct gaagaagaaa aagatgaaaa ttacggtagg gtggtgctca accgacataa ttcccatgat gcattggaca ggaaagtaaa tgagagagat gtgccaaaag ctacaattag tcggtacagt tctgatgaca ctttggacag gagcatgtcc atgtttagat cactggaagt aacaaagttg caacctggcg gttcattgaa tgccaacacc tccaacacca tagcatccac ttctgctact actcctgtaa agaagaagag gcagtcctgg tttccaccgc cccctccagg ttacaatgcc tcttcgagca caggaaccag gagacgggaa ccaggtgttc accctccaat acctccaaag cccagttctc ctgtttcttc tcctaaccag ctgagacagg ataataggca gatacatcca cctaaaccag gtgtatatac agaaaccaac agatctgctg aaagaaatat aagtgaagaa ttggataatc tcatcaaaat gaacaaaagc ttgaatagga atcaaggtct tgatagtctc ttcagagcaa atccaaaggt agaagaaaga gagaaaaaag ccaaaagcct tgaaagtctc atctatatga gtacccggac agataaagat ggcaaaggaa tccaaagcct tggaagtccg attaaagtta atcaaaggac tgacaaaaat gagaaagggt aa. It is sometimes possible for the material contained within the vial of "SCEL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.