Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCARB2 cdna clone

SCARB2 cDNA Clone

Gene Names
SCARB2; AMRF; EPM4; LGP85; CD36L2; HLGP85; LIMP-2; LIMPII; SR-BII
Synonyms
SCARB2; SCARB2 cDNA Clone; SCARB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggccgatgctgcttctacacggcggggacgttgtccctgctcctgctggtgaccagcgtcacgctgctggtggcccgggtcttccagaaggctgtagaccagagtatcgagaagaaaattgtgttaaggaatggtactgaggcatttgactcctgggagaagccccctctgcctgtgtatactcagttctatttcttcaatgtcaccaatccagaggagatcctcagaggggagacccctcgggtggaagaagtggggccatacacctacagggaactcagaaacaaagcaaatattcaatttggagataatggaacaacaatatctgctgttagcaacaaggcctatgtttttgaacgagaccaatctgttggagaccctaaaattgacttaattagaacattaaatattcctgtattgactgtcatagagtggtcccaggtgcacttcctcagggagatcatcgaggccatgttgaaagcctatcagcagaagctctttgtgactcacacagttgacgaattgctctggggctacaaagatgaaatcttgtcccttatccatgttttcaggcccgatatctctccctattttggcctattctatgagaaaaatgggactaatgatggagactatgtttttctaactggagaagacagttaccttaactttacaaaaattgtggaatggaatgggaaaacgtcacttgactggtggataacagacaagtgcaatatgattaatggaacagatggagattcttttcacccactaataaccaaagatgaggtcctttatgtcttcccatctgacttttgcaggtcagtgtatattactttcagtgactatgagagtgtacagggactgcctgcctttcggtataaagttcctgcagaaatattagccaatacgtcagacaatgccggcttctgtatacctgagggaaactgcctgggctcaggagttctgaatgtcagcatctgcaagaatggtgcacccatcattatgtctttcccacacttttaccaagcagatgagaggtttgtttctgccatagaaggcatgcacccaaatcaggaagaccatgagacatttgtggacattaatcctttgactggaataatcctaaaagcagccaagaggttccaaatcaacatttatgtcaaaaaattagatgactttgttgaaacgggagacattagaaccatggttttcccagtgatgtacctcaatgagagtgttcacattgataaagagacggcgagtcgactgaagtctatgattaacactactttgatcatcaccaacataccctacatcatcatggcgctgggtgtgttctttggtttggtttttacctggcttgcatgcaaaggacagggatccatggatgagggaacagcggatgaaagagcacccctcattcgaacctaa
Sequence Length
1437
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
950
Molecular Weight
37,767 Da
NCBI Official Full Name
Homo sapiens scavenger receptor class B, member 2, mRNA
NCBI Official Synonym Full Names
scavenger receptor class B member 2
NCBI Official Symbol
SCARB2
NCBI Official Synonym Symbols
AMRF; EPM4; LGP85; CD36L2; HLGP85; LIMP-2; LIMPII; SR-BII
NCBI Protein Information
lysosome membrane protein 2
UniProt Protein Name
Lysosome membrane protein 2
Protein Family
UniProt Gene Name
SCARB2
UniProt Synonym Gene Names
CD36L2; LIMP2; LIMPII; LGP85; LIMP II
UniProt Entry Name
SCRB2_HUMAN

NCBI Description

The protein encoded by this gene is a type III glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes. Earlier studies in mice and rat suggested that this protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. The protein deficiency in mice was reported to impair cell membrane transport processes and cause pelvic junction obstruction, deafness, and peripheral neuropathy. Further studies in human showed that this protein is a ubiquitously expressed protein and that it is involved in the pathogenesis of HFMD (hand, foot, and mouth disease) caused by enterovirus-71 and possibly by coxsackievirus A16. Mutations in this gene caused an autosomal recessive progressive myoclonic epilepsy-4 (EPM4), also known as action myoclonus-renal failure syndrome (AMRF). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]

Uniprot Description

SCARB2: Acts as a lysosomal receptor for glucosylceramidase (GBA) targeting. Defects in SCARB2 are the cause of progressive myoclonic epilepsy type 4 with or without renal failure (EPM4). An autosomal recessive progressive myoclonic epilepsy associated with renal failure in some cases. Cognitive function is preserved. Myoclonus is a brief, involuntary twitching of a muscle or a group of muscles. Cognitive function is preserved. Genetic variants in SCARB2 can act as modifier of the phenotypic expression and severity of Gaucher disease. Belongs to the CD36 family.

Protein type: Receptor, misc.; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 4q21.1

Cellular Component: focal adhesion; lysosomal lumen; lysosomal membrane; membrane

Molecular Function: enzyme binding; protein binding

Biological Process: protein targeting to lysosome

Disease: Epilepsy, Progressive Myoclonic 4, With Or Without Renal Failure

Research Articles on SCARB2

Similar Products

Product Notes

The SCARB2 scarb2 (Catalog #AAA1270031) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccgat gctgcttcta cacggcgggg acgttgtccc tgctcctgct ggtgaccagc gtcacgctgc tggtggcccg ggtcttccag aaggctgtag accagagtat cgagaagaaa attgtgttaa ggaatggtac tgaggcattt gactcctggg agaagccccc tctgcctgtg tatactcagt tctatttctt caatgtcacc aatccagagg agatcctcag aggggagacc cctcgggtgg aagaagtggg gccatacacc tacagggaac tcagaaacaa agcaaatatt caatttggag ataatggaac aacaatatct gctgttagca acaaggccta tgtttttgaa cgagaccaat ctgttggaga ccctaaaatt gacttaatta gaacattaaa tattcctgta ttgactgtca tagagtggtc ccaggtgcac ttcctcaggg agatcatcga ggccatgttg aaagcctatc agcagaagct ctttgtgact cacacagttg acgaattgct ctggggctac aaagatgaaa tcttgtccct tatccatgtt ttcaggcccg atatctctcc ctattttggc ctattctatg agaaaaatgg gactaatgat ggagactatg tttttctaac tggagaagac agttacctta actttacaaa aattgtggaa tggaatggga aaacgtcact tgactggtgg ataacagaca agtgcaatat gattaatgga acagatggag attcttttca cccactaata accaaagatg aggtccttta tgtcttccca tctgactttt gcaggtcagt gtatattact ttcagtgact atgagagtgt acagggactg cctgcctttc ggtataaagt tcctgcagaa atattagcca atacgtcaga caatgccggc ttctgtatac ctgagggaaa ctgcctgggc tcaggagttc tgaatgtcag catctgcaag aatggtgcac ccatcattat gtctttccca cacttttacc aagcagatga gaggtttgtt tctgccatag aaggcatgca cccaaatcag gaagaccatg agacatttgt ggacattaat cctttgactg gaataatcct aaaagcagcc aagaggttcc aaatcaacat ttatgtcaaa aaattagatg actttgttga aacgggagac attagaacca tggttttccc agtgatgtac ctcaatgaga gtgttcacat tgataaagag acggcgagtc gactgaagtc tatgattaac actactttga tcatcaccaa cataccctac atcatcatgg cgctgggtgt gttctttggt ttggttttta cctggcttgc atgcaaagga cagggatcca tggatgaggg aacagcggat gaaagagcac ccctcattcg aacctaa. It is sometimes possible for the material contained within the vial of "SCARB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.