Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

SCAMP3 cdna clone

SCAMP3 cDNA Clone

Gene Names
SCAMP3; C1orf3
Synonyms
SCAMP3; SCAMP3 cDNA Clone; SCAMP3 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggctcagagcagagacggcggaaacccgttcgccgagcccagcgagcttgacaacccctttcaggacccagctgtgatccagcaccgacccagccggcagtatgccacgcttgacgtctacaacccttttgagacccgggagccaccaccagcctatgagcctccagcccctgccccattgcctccaccctcagctccctccttgcagccctcgagaaagctcagccccacagaacctaagaactatggctcatacagcactcaggcctcagctgcagcagccacagctgagctgctgaagaaacaggaggagctcaaccggaaggcagaggagttggaccgaagggagcgagagctgcagcatgctgccctggggggcacagctactcgacagaacaattggccccctctaccttctttttgtccagttcagccctgctttttccaggacatctccatggagatcccccaagaatttcagaagactgtatccaccatgtactacctctggatgtgcagcacgctggctcttctcctgaacttcctcgcctgcctggccagcttctgtgtggaaaccaacaatggcgcaggctttgggctttctatcctctgggtcctccttttcactccctgctcctttgtctgctggtaccgccccatgtataaggctttccggagtgacagttcattcaatttcttcgttttcttcttcattttcttcgtccaggatgtgctctttgtcctccaggccattggtatcccaggttggggattcagtggctggatctctgctctggtggtgccgaagggcaacacagcagtatccgtgctcatgctgctggtcgccctgctcttcactggcattgctgtgctaggaattgtcatgctgaaacggatccactccttataccgccgcacaggtgccagctttcagaaggcccagcaagaatttgctgctggtgtcttctccaaccctgcggtgcgaaccgcagctgccaatgcagccgctggggctgctgaaaatgccttccgggccccgtga
Sequence Length
1044
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,202 Da
NCBI Official Full Name
Homo sapiens secretory carrier membrane protein 3, mRNA
NCBI Official Synonym Full Names
secretory carrier membrane protein 3
NCBI Official Symbol
SCAMP3
NCBI Official Synonym Symbols
C1orf3
NCBI Protein Information
secretory carrier-associated membrane protein 3
UniProt Protein Name
Secretory carrier-associated membrane protein 3
UniProt Gene Name
SCAMP3
UniProt Synonym Gene Names
C1orf3; PROPIN1; Secretory carrier membrane protein 3
UniProt Entry Name
SCAM3_HUMAN

NCBI Description

This gene encodes an integral membrane protein that belongs to the secretory carrier membrane protein family. The encoded protein functions as a carrier to the cell surface in post-golgi recycling pathways. This protein is also involved in protein trafficking in endosomal pathways. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]

Uniprot Description

SCAMP3: an integral membrane of the SCAMP family. Acts as a recycling carrier to the cell surface. Functions in post-Golgi recycling pathways. Two alternatively spliced isoforms have been described.

Protein type: Vesicle; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: intracellular membrane-bound organelle

Molecular Function: ubiquitin protein ligase binding

Biological Process: post-Golgi vesicle-mediated transport

Research Articles on SCAMP3

Similar Products

Product Notes

The SCAMP3 scamp3 (Catalog #AAA1273717) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcaga gcagagacgg cggaaacccg ttcgccgagc ccagcgagct tgacaacccc tttcaggacc cagctgtgat ccagcaccga cccagccggc agtatgccac gcttgacgtc tacaaccctt ttgagacccg ggagccacca ccagcctatg agcctccagc ccctgcccca ttgcctccac cctcagctcc ctccttgcag ccctcgagaa agctcagccc cacagaacct aagaactatg gctcatacag cactcaggcc tcagctgcag cagccacagc tgagctgctg aagaaacagg aggagctcaa ccggaaggca gaggagttgg accgaaggga gcgagagctg cagcatgctg ccctgggggg cacagctact cgacagaaca attggccccc tctaccttct ttttgtccag ttcagccctg ctttttccag gacatctcca tggagatccc ccaagaattt cagaagactg tatccaccat gtactacctc tggatgtgca gcacgctggc tcttctcctg aacttcctcg cctgcctggc cagcttctgt gtggaaacca acaatggcgc aggctttggg ctttctatcc tctgggtcct ccttttcact ccctgctcct ttgtctgctg gtaccgcccc atgtataagg ctttccggag tgacagttca ttcaatttct tcgttttctt cttcattttc ttcgtccagg atgtgctctt tgtcctccag gccattggta tcccaggttg gggattcagt ggctggatct ctgctctggt ggtgccgaag ggcaacacag cagtatccgt gctcatgctg ctggtcgccc tgctcttcac tggcattgct gtgctaggaa ttgtcatgct gaaacggatc cactccttat accgccgcac aggtgccagc tttcagaagg cccagcaaga atttgctgct ggtgtcttct ccaaccctgc ggtgcgaacc gcagctgcca atgcagccgc tggggctgct gaaaatgcct tccgggcccc gtga. It is sometimes possible for the material contained within the vial of "SCAMP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual