Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCAMP1 cdna clone

SCAMP1 cDNA Clone

Gene Names
SCAMP1; SCAMP; SCAMP37
Synonyms
SCAMP1; SCAMP1 cDNA Clone; SCAMP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatacacaaccagcaataatgaaaccaacagaggaacatccagcttatacacagattgcaaaggaacatgcattggcccaagctgaacttcttaagcgccaggaagaactagaaagaaaagccgcagaattagatcgtcgggaacgagaaatgcaaaacctcagtcaacatggtagaaaaaataattggccacctcttcctagcaattttcctgtcggaccttgtttctatcaggatttttctgtagacattcctgtagaattccaaaagacagtaaagcttatgtactacttgtggatgtga
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,042 Da
NCBI Official Full Name
Homo sapiens secretory carrier membrane protein 1, mRNA
NCBI Official Synonym Full Names
secretory carrier membrane protein 1
NCBI Official Symbol
SCAMP1
NCBI Official Synonym Symbols
SCAMP; SCAMP37
NCBI Protein Information
secretory carrier-associated membrane protein 1
UniProt Protein Name
Secretory carrier-associated membrane protein 1
UniProt Gene Name
SCAMP1
UniProt Synonym Gene Names
SCAMP; Secretory carrier membrane protein 1
UniProt Entry Name
SCAM1_HUMAN

NCBI Description

This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Uniprot Description

SCAMP1: Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface. Belongs to the SCAMP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 5q14.1

Cellular Component: cell junction; clathrin-coated vesicle; integral to membrane; intracellular membrane-bound organelle; nucleoplasm; recycling endosome membrane; trans-Golgi network

Molecular Function: protein binding

Biological Process: post-Golgi vesicle-mediated transport; protein transport

Research Articles on SCAMP1

Similar Products

Product Notes

The SCAMP1 scamp1 (Catalog #AAA1267246) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggatt tcgacagtaa cccgtttgcc gacccggatc tcaacaatcc cttcaaggat ccatcagtta cacaagtgac aagaaatgtt ccaccaggac ttgatgaata taatccattc tcggattcta gaacacctcc accaggcggt gtgaagatgc ctaatgtacc caatacacaa ccagcaataa tgaaaccaac agaggaacat ccagcttata cacagattgc aaaggaacat gcattggccc aagctgaact tcttaagcgc caggaagaac tagaaagaaa agccgcagaa ttagatcgtc gggaacgaga aatgcaaaac ctcagtcaac atggtagaaa aaataattgg ccacctcttc ctagcaattt tcctgtcgga ccttgtttct atcaggattt ttctgtagac attcctgtag aattccaaaa gacagtaaag cttatgtact acttgtggat gtga. It is sometimes possible for the material contained within the vial of "SCAMP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.