SATL1 cdna clone
SATL1 cDNA Clone
Synonyms
SATL1; SATL1 cDNA Clone; SATL1 cdna clone
Sequence
atgagtccaccaggcatgtggcaaccaggcgtgcaacaaccaggcatcagccagcaagtcccaagccacccagacatgagtcaaccaggcatgagccagcaagtccccagccaaccaggcataaggcaaccagacactagccaatcatgtaagaaccaaacagacatgagccaaccagacgcaaaccaatcaagtttatcagattccaaccaaacaggtataatccagccaagcccaagcttacttggtatgaaccaaatggacatgaaccaacggagtgcaagcctatatgaaatgaaccaagtggacatgaaacaaccaagcatgagccaagctggcatgaggcaatcaggtacaaacctaccagacataaaccaacctggcatgaaacaaccaggcacatggcaattaggtaggagccaaccaggcatgtggccacaaagcctgagcgaactagtcctgagtgaagcaagcataagccaaccaggtccaccgcaacgagccccaagccaatcaggccccagacaatcaagcacgagccaagcaggcacaaaccaatcaggtataagccaaccagtgatgtggcaactagacatgagacagtcaggtgggagccaaccaagcatgagacaagtaggcaccagccaatcaggcacaagccaaataggcatgagccaaccaggcacatggcaaacaggcctgagccaaccagtcctgaggcaaccaaacaagagtccaccaggcatgtggcaacgaggcatgtggcaaccaggcatgagccagcaagtccccagccaactaggcatgagacaaccaggcactagccaatcaagtaagaaccaaacaggcatgagccatccaggcaggggccaaccaggcatatgggaaccggggccgagtcagccaggcctgagccaacaagacctgaaccaattagtgctgagccaaccaggcctgagtcaaccaggcaggagccaaccaagtgtgagccaaatgggcatgaggcaaacaagcatggattactttcaaataagacatgcagaggctggagactgcccagaaattttgcgactgattaaagaattggctgcctgtgaaaacatgctagatgcaatggagttaacagcagctgatttactcagagatggctttggggacaatccccttttctactgcctgattgcagaagtaaacgatcaacaaaaaccatcaggcaaactgactgttggatttgccatgtactactttacatacgactcatggactggcaaggtactttacctagaggacttttatgtcacacaagcttaccaagatagccatcacaactcaatgtaa
Sequence Length
1338
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,530 Da
NCBI Official Full Name
Homo sapiens spermidine/spermine N1-acetyl transferase-like 1, mRNA
NCBI Official Synonym Full Names
spermidine/spermine N1-acetyl transferase-like 1
NCBI Official Symbol
SATL1
NCBI Protein Information
spermidine/spermine N(1)-acetyltransferase-like protein 1
UniProt Protein Name
Spermidine/spermine N(1)-acetyltransferase-like protein 1
Protein Family
UniProt Gene Name
SATL1
UniProt Entry Name
SATL1_HUMAN
Uniprot Description
SATL1: Belongs to the acetyltransferase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 2.3.1.-; Acetyltransferase
Chromosomal Location of Human Ortholog: Xq21.1
Similar Products
Product Notes
The SATL1 satl1 (Catalog #AAA1276384) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtccac caggcatgtg gcaaccaggc gtgcaacaac caggcatcag ccagcaagtc ccaagccacc cagacatgag tcaaccaggc atgagccagc aagtccccag ccaaccaggc ataaggcaac cagacactag ccaatcatgt aagaaccaaa cagacatgag ccaaccagac gcaaaccaat caagtttatc agattccaac caaacaggta taatccagcc aagcccaagc ttacttggta tgaaccaaat ggacatgaac caacggagtg caagcctata tgaaatgaac caagtggaca tgaaacaacc aagcatgagc caagctggca tgaggcaatc aggtacaaac ctaccagaca taaaccaacc tggcatgaaa caaccaggca catggcaatt aggtaggagc caaccaggca tgtggccaca aagcctgagc gaactagtcc tgagtgaagc aagcataagc caaccaggtc caccgcaacg agccccaagc caatcaggcc ccagacaatc aagcacgagc caagcaggca caaaccaatc aggtataagc caaccagtga tgtggcaact agacatgaga cagtcaggtg ggagccaacc aagcatgaga caagtaggca ccagccaatc aggcacaagc caaataggca tgagccaacc aggcacatgg caaacaggcc tgagccaacc agtcctgagg caaccaaaca agagtccacc aggcatgtgg caacgaggca tgtggcaacc aggcatgagc cagcaagtcc ccagccaact aggcatgaga caaccaggca ctagccaatc aagtaagaac caaacaggca tgagccatcc aggcaggggc caaccaggca tatgggaacc ggggccgagt cagccaggcc tgagccaaca agacctgaac caattagtgc tgagccaacc aggcctgagt caaccaggca ggagccaacc aagtgtgagc caaatgggca tgaggcaaac aagcatggat tactttcaaa taagacatgc agaggctgga gactgcccag aaattttgcg actgattaaa gaattggctg cctgtgaaaa catgctagat gcaatggagt taacagcagc tgatttactc agagatggct ttggggacaa tccccttttc tactgcctga ttgcagaagt aaacgatcaa caaaaaccat caggcaaact gactgttgga tttgccatgt actactttac atacgactca tggactggca aggtacttta cctagaggac ttttatgtca cacaagctta ccaagatagc catcacaact caatgtaa. It is sometimes possible for the material contained within the vial of "SATL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
