Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SASH3 cdna clone

SASH3 cDNA Clone

Gene Names
SASH3; SLY; 753P9; HACS2; CXorf9; SH3D6C
Synonyms
SASH3; SASH3 cDNA Clone; SASH3 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcgccgcaagccctccaatgccagtgagaaggagcccactcagaagaaaaagctctcccttcagcgctccagcagcttcaaggattttgccaaatccaaacccagctcccccgtggtgagcgagaaggagtttaatctggatgataacattccagaagatgactcaggtgtccccaccccagaagatgctgggaagagtggcaaaaagctggggaagaagtggagggcagtgatttcccgaaccatgaacaggaagatgggcaagatgatggtgaaggccctgtcagaagagatggcagacactctggaggagggctctgcctccccgacatctccagactacagcctggacagccctggccctgagaagatggcgctggccttttctgagcaagaggagcatgaacttccggtgctcagccgccaggcatcaacaggcagtgagctctgcagccccagcccaggttctggcagcttcggggaggaaccacctgccccccagtacacagggcctttctgtggccgggcacgagtccacaccgacttcactcccagcccctatgaccacgactcgctgaaactgcagaaaggagatgtgatccagatcattgaaaagccacctgtgggcacgtggctgggcctactcaatggcaaggtgggctctttcaaattcatctatgtggatgtgctgcccgaggaggccgtggggcatgcccgccccagccgccgacagagcaagggcaagaggcccaagcctaagaccctgcatgagctgctggagcgcatcggcctggaggagcacacatccaccctcctgctcaatggctaccagacactggaagacttcaaagagctgcgagaaacacacctcaatgagctgaacatcatggatccacagcaccgggccaagctgctcacggccgccgagctgctgctggactatgacactggcagtgaggaggctgaagagggcgccgagagcagccaggagccagtggcacacacagtgtcggaacccaaggtggacatcccgcgcgactcaggctgctttgagggctcggagagcgggcgcgatgacgcagagctggcaggcactgaggagcagctgcaaggcctctccctggccggggcaccttga
Sequence Length
1143
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,595 Da
NCBI Official Full Name
Homo sapiens SAM and SH3 domain containing 3, mRNA
NCBI Official Synonym Full Names
SAM and SH3 domain containing 3
NCBI Official Symbol
SASH3
NCBI Official Synonym Symbols
SLY; 753P9; HACS2; CXorf9; SH3D6C
NCBI Protein Information
SAM and SH3 domain-containing protein 3
UniProt Protein Name
SAM and SH3 domain-containing protein 3
UniProt Gene Name
SASH3
UniProt Synonym Gene Names
CXorf9; SLY
UniProt Entry Name
SASH3_HUMAN

NCBI Description

The protein encoded by this gene contains a Src homology-3 (SH3) domain and a sterile alpha motif (SAM), both of which are found in proteins involved in cell signaling. This protein may function as a signaling adapter protein in lymphocytes.[provided by RefSeq, Sep 2009]

Uniprot Description

SLY: May function as a signaling adapter protein in lymphocytes.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: Xq26

Similar Products

Product Notes

The SASH3 sash3 (Catalog #AAA1273954) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcgcc gcaagccctc caatgccagt gagaaggagc ccactcagaa gaaaaagctc tcccttcagc gctccagcag cttcaaggat tttgccaaat ccaaacccag ctcccccgtg gtgagcgaga aggagtttaa tctggatgat aacattccag aagatgactc aggtgtcccc accccagaag atgctgggaa gagtggcaaa aagctgggga agaagtggag ggcagtgatt tcccgaacca tgaacaggaa gatgggcaag atgatggtga aggccctgtc agaagagatg gcagacactc tggaggaggg ctctgcctcc ccgacatctc cagactacag cctggacagc cctggccctg agaagatggc gctggccttt tctgagcaag aggagcatga acttccggtg ctcagccgcc aggcatcaac aggcagtgag ctctgcagcc ccagcccagg ttctggcagc ttcggggagg aaccacctgc cccccagtac acagggcctt tctgtggccg ggcacgagtc cacaccgact tcactcccag cccctatgac cacgactcgc tgaaactgca gaaaggagat gtgatccaga tcattgaaaa gccacctgtg ggcacgtggc tgggcctact caatggcaag gtgggctctt tcaaattcat ctatgtggat gtgctgcccg aggaggccgt ggggcatgcc cgccccagcc gccgacagag caagggcaag aggcccaagc ctaagaccct gcatgagctg ctggagcgca tcggcctgga ggagcacaca tccaccctcc tgctcaatgg ctaccagaca ctggaagact tcaaagagct gcgagaaaca cacctcaatg agctgaacat catggatcca cagcaccggg ccaagctgct cacggccgcc gagctgctgc tggactatga cactggcagt gaggaggctg aagagggcgc cgagagcagc caggagccag tggcacacac agtgtcggaa cccaaggtgg acatcccgcg cgactcaggc tgctttgagg gctcggagag cgggcgcgat gacgcagagc tggcaggcac tgaggagcag ctgcaaggcc tctccctggc cggggcacct tga. It is sometimes possible for the material contained within the vial of "SASH3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.