Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

S100A6 cdna clone

S100A6 cDNA Clone

Gene Names
S100A6; 2A9; PRA; 5B10; CABP; CACY
Synonyms
S100A6; S100A6 cDNA Clone; S100A6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatgccccctggatcaggccattggcctcctcgtggccatcttccacaagtactccggcagggagggtgacaagcacaccctgagcaagaaggagctgaaggagctgatccagaaggagctcaccattggctcgaagctgcaggatgctgaaattgcaaggctgatggaagacttggaccggaacaaggaccaggaggtgaacttccaggagtatgtcaccttcctgggggccttggctttgatctacaatgaagccctcaagggctga
Sequence Length
273
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,180 Da
NCBI Official Full Name
Homo sapiens S100 calcium binding protein A6, mRNA
NCBI Official Synonym Full Names
S100 calcium binding protein A6
NCBI Official Symbol
S100A6
NCBI Official Synonym Symbols
2A9; PRA; 5B10; CABP; CACY
NCBI Protein Information
protein S100-A6
UniProt Protein Name
Protein S100-A6
Protein Family
UniProt Gene Name
S100A6
UniProt Synonym Gene Names
CACY; PRA
UniProt Entry Name
S10A6_HUMAN

NCBI Description

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008]

Uniprot Description

S100A6: May function as calcium sensor and contribute to cellular calcium signaling (Potential). May function by interacting with other proteins and indirectly play a role in the reorganization of the actin cytoskeleton and in cell motility. Binds 2 calcium ions. Calcium binding is cooperative. Belongs to the S-100 family.

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: cytoplasm; cytosol; extrinsic to internal side of plasma membrane; nuclear envelope; nucleus; perinuclear region of cytoplasm; ruffle

Molecular Function: calcium ion binding; calcium-dependent protein binding; protein binding; protein homodimerization activity; tropomyosin binding

Biological Process: signal transduction

Research Articles on S100A6

Similar Products

Product Notes

The S100A6 s100a6 (Catalog #AAA1274879) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatgcc ccctggatca ggccattggc ctcctcgtgg ccatcttcca caagtactcc ggcagggagg gtgacaagca caccctgagc aagaaggagc tgaaggagct gatccagaag gagctcacca ttggctcgaa gctgcaggat gctgaaattg caaggctgat ggaagacttg gaccggaaca aggaccagga ggtgaacttc caggagtatg tcaccttcct gggggccttg gctttgatct acaatgaagc cctcaagggc tga. It is sometimes possible for the material contained within the vial of "S100A6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.