Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RYBP cdna clone

RYBP cDNA Clone

Gene Names
RYBP; AAP1; DEDAF; YEAF1; APAP-1
Synonyms
RYBP; RYBP cDNA Clone; RYBP cdna clone
Ordering
For Research Use Only!
Sequence
atgaccatgggcgacaagaagagcccgaccaggccaaaaagacaagcgaaacctgccgcagacgaagggttttgggattgtagcgtctgcaccttcagaaacagtgctgaagcctttaaatgcagcatctgcgatgtgaggaaaggcacctccaccagaaaacctcggatcaattctcagctggtggcgcaacaagtggcacaacagtatgccaccccaccaccccctaaaaaggagaagaaggagaaagttgaaaagcaggacaaagagaaacctgagaaagacaaggaaattagtcctagtgttaccaagaaaaataccaacaagaaaaccaaaccaaagtctgacattctgaaagatcctcctagtgaagcaaacagcatacagtctgcaaatgctacaacaaagaccagcgaaacaaatcacacctcaaggccccggctgaaaaacgtggacaggagcactgcacagcagttggcagtaactgtgggcaacgtcaccgtcattatcacagactttaaggaaaagactcgctcctcatcgacatcctcatccacagtgacctccagtgcagggtcagaacagcagaaccagagcagctcggggtcagagagcacagacaagggctcctcccgttcctccacgccaaagggcgacatgtcagcagtcaatgatgaatctttctga
Sequence Length
687
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,822 Da
NCBI Official Full Name
Homo sapiens RING1 and YY1 binding protein, mRNA
NCBI Official Synonym Full Names
RING1 and YY1 binding protein
NCBI Official Symbol
RYBP
NCBI Official Synonym Symbols
AAP1; DEDAF; YEAF1; APAP-1
NCBI Protein Information
RING1 and YY1-binding protein
UniProt Protein Name
RING1 and YY1-binding protein
UniProt Gene Name
RYBP
UniProt Synonym Gene Names
DEDAF; YEAF1; APAP-1; DED-associated factor
UniProt Entry Name
RYBP_HUMAN

Uniprot Description

RYBP: Inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes. May be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1. May bind to DNA. Promotes apoptosis.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 3p13

Cellular Component: nucleoplasm; PcG protein complex

Molecular Function: protein binding

Biological Process: multicellular organismal development

Research Articles on RYBP

Similar Products

Product Notes

The RYBP rybp (Catalog #AAA1274921) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccatgg gcgacaagaa gagcccgacc aggccaaaaa gacaagcgaa acctgccgca gacgaagggt tttgggattg tagcgtctgc accttcagaa acagtgctga agcctttaaa tgcagcatct gcgatgtgag gaaaggcacc tccaccagaa aacctcggat caattctcag ctggtggcgc aacaagtggc acaacagtat gccaccccac caccccctaa aaaggagaag aaggagaaag ttgaaaagca ggacaaagag aaacctgaga aagacaagga aattagtcct agtgttacca agaaaaatac caacaagaaa accaaaccaa agtctgacat tctgaaagat cctcctagtg aagcaaacag catacagtct gcaaatgcta caacaaagac cagcgaaaca aatcacacct caaggccccg gctgaaaaac gtggacagga gcactgcaca gcagttggca gtaactgtgg gcaacgtcac cgtcattatc acagacttta aggaaaagac tcgctcctca tcgacatcct catccacagt gacctccagt gcagggtcag aacagcagaa ccagagcagc tcggggtcag agagcacaga caagggctcc tcccgttcct ccacgccaaa gggcgacatg tcagcagtca atgatgaatc tttctga. It is sometimes possible for the material contained within the vial of "RYBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.