Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RUVBL2 cdna clone

RUVBL2 cDNA Clone

Gene Names
RUVBL2; RVB2; TIH2; ECP51; TIP48; CGI-46; ECP-51; INO80J; REPTIN; TIP49B; TAP54-beta
Synonyms
RUVBL2; RUVBL2 cDNA Clone; RUVBL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaccgttacagccacaaccaaagtcccggagatccgtgatgtaacaaggattgagcgaatcggtgcccactcccacatccggggactggggctggacgatgccttggagcctcggcaggcttcgcaaggcatggtgggtcagctggcggcacggcgggcggctggcgtggtgctggagatgatccgggaagggaagattgccggtcgggcagtccttattgctggccagccgggcacggggaagacggccatcgccatgggcatggcgcaggccctgggccctgacacgccattcacagccatcgccggcagtgaaatcttctccctggagatgagcaagaccgaggcgctgacgcaggccttccggcggtccatcggcgttcgcatcaaggaggagacggagatcatcgaaggggaggtggtggagatccagattgatcgaccagcaacagggacgggctccaaggtgggcaaactgaccctcaagaccacagagatggagaccatctacgacctgggcaccaagatgattgagtccctgaccaaggacaaggtccaggccggggacgtgatcaccatcgacaaggcgacgggcaagatctccaagctgggccgctccttcacacgcgcccgcgactacgacgctatgggctcccagaccaagttcgtgcagtgcccagatggggagctccagaaacgcaaggaggtggtgcacaccgtgtccctgcacgagatcgacgtcatcaactctcgcacccagggcttcctggcgctcttctcaggtgacacaggggagatcaagtcagaagtccgtgagcagatcaatgccaaggtggctgagtggcgcgaggagggcaaggcggagatcatccctggagtgctgttcatcgacgaggtccacatgctggacatcgagagcttctccttcctcaaccgggccctggagagtgacatggcgcctgtcctgatcatggccaccaaccgtggcatcacgcgaatccggggcaccagctaccagagccctcacggcatccccatagacctgctggaccggctgcttatcgtctccaccaccccctacagcgagaaagacacgaagcagatcctccgcatccggtgcgaggaagaagatgtggagatgagtgaggacgcctacacggtgctgacccgcatcgggctggagacgtcactgcgctacgccatccagctcatcacagctgccagcttggtgtgccggaaacgcaagggtacagaagtgcaggtggatgacatcaagcgggtctactcactcttcctggacgagtcccgctccacgcagtacatgaaggagtaccaggacgccttcctcttcaacgaactcaaaggcgagaccatggacacctcctga
Sequence Length
1392
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,306 Da
NCBI Official Full Name
Homo sapiens RuvB-like 2 (E. coli), mRNA
NCBI Official Synonym Full Names
RuvB like AAA ATPase 2
NCBI Official Symbol
RUVBL2
NCBI Official Synonym Symbols
RVB2; TIH2; ECP51; TIP48; CGI-46; ECP-51; INO80J; REPTIN; TIP49B; TAP54-beta
NCBI Protein Information
ruvB-like 2
UniProt Protein Name
RuvB-like 2
Protein Family
UniProt Gene Name
RUVBL2
UniProt Synonym Gene Names
INO80J; TIP48; TIP49B; 48 kDa TBP-interacting protein; ECP-51; Reptin 52; TAP54-beta
UniProt Entry Name
RUVB2_HUMAN

NCBI Description

This gene encodes the second human homologue of the bacterial RuvB gene. Bacterial RuvB protein is a DNA helicase essential for homologous recombination and DNA double-strand break repair. Functional analysis showed that this gene product has both ATPase and DNA helicase activities. This gene is physically linked to the CGB/LHB gene cluster on chromosome 19q13.3, and is very close (55 nt) to the LHB gene, in the opposite orientation. [provided by RefSeq, Jul 2008]

Uniprot Description

RUVBL2: Possesses single-stranded DNA-stimulated ATPase and ATP- dependent DNA helicase (5' to 3') activity; hexamerization is thought to be critical for ATP hydrolysis and adjacent subunits in the ring-like structure contribute to the ATPase activity. Forms homohexameric rings (Probable). Can form a dodecamer with RUVBL1 made of two stacked hexameric rings; however, even though RUVBL1 and RUVBL2 are present in equimolar ratio, the oligomeric status of each hexamer is not known. Oligomerization may regulate binding to nucleic acids and conversely, binding to nucleic acids may affect the dodecameric assembly. Interacts with the transcriptional activation domain of MYC. Interacts With ATF2. Component of the RNA polymerase II holoenzyme complex. May also act to bridge the LEF1/TCF1-CTNNB1 complex and TBP. Component of the NuA4 histone acetyltransferase complex which contains the catalytic subunit KAT5/TIP60 and the subunits EP400, TRRAP/PAF400, BRD8/SMAP, EPC1, DMAP1/DNMAP1, RUVBL1/TIP49, RUVBL2, ING3, actin, ACTL6A/BAF53A, MORF4L1/MRG15, MORF4L2/MRGX, MRGBP, YEATS4/GAS41, VPS72/YL1 and MEAF6. The NuA4 complex interacts with MYC and the adenovirus E1A protein. RUVBL2 interacts with EP400. Component of a NuA4-related complex which contains EP400, TRRAP/PAF400, SRCAP, BRD8/SMAP, EPC1, DMAP1/DNMAP1, RUVBL1/TIP49, RUVBL2, actin, ACTL6A/BAF53A, VPS72 and YEATS4/GAS41. Interacts with NPAT. Component of the chromatin- remodeling INO80 complex; specifically part of a complex module associated with the helicase ATP-binding and the helicase C- terminal domain of INO80. Component of some MLL1/MLL complex, at least composed of the core components MLL, ASH2L, HCFC1/HCF1, WDR5 and RBBP5, as well as the facultative components C17orf49, CHD8, E2F6, HSP70, INO80C, KANSL1, LAS1L, MAX, MCRS1, MGA, MYST1/MOF, PELP1, PHF20, PRP31, RING2, RUVB1/TIP49A, RUVB2/TIP49B, SENP3, TAF1, TAF4, TAF6, TAF7, TAF9 and TEX10. Interacts with IGHMBP2. Interacts with TELO2. Ubiquitously expressed. Highly expressed in testis and thymus. Belongs to the RuvB family.

Protein type: Helicase; EC 3.6.4.12

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: cytoplasm; intracellular; NuA4 histone acetyltransferase complex; nucleoplasm; nucleus

Molecular Function: ATP-dependent DNA helicase activity; ATPase activity; chromatin DNA binding; DNA helicase activity; identical protein binding; protein binding; unfolded protein binding

Biological Process: box C/D snoRNP assembly; chromatin remodeling; positive regulation of histone acetylation; positive regulation of transcription from RNA polymerase II promoter; protein folding

Research Articles on RUVBL2

Similar Products

Product Notes

The RUVBL2 ruvbl2 (Catalog #AAA1269265) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaccg ttacagccac aaccaaagtc ccggagatcc gtgatgtaac aaggattgag cgaatcggtg cccactccca catccgggga ctggggctgg acgatgcctt ggagcctcgg caggcttcgc aaggcatggt gggtcagctg gcggcacggc gggcggctgg cgtggtgctg gagatgatcc gggaagggaa gattgccggt cgggcagtcc ttattgctgg ccagccgggc acggggaaga cggccatcgc catgggcatg gcgcaggccc tgggccctga cacgccattc acagccatcg ccggcagtga aatcttctcc ctggagatga gcaagaccga ggcgctgacg caggccttcc ggcggtccat cggcgttcgc atcaaggagg agacggagat catcgaaggg gaggtggtgg agatccagat tgatcgacca gcaacaggga cgggctccaa ggtgggcaaa ctgaccctca agaccacaga gatggagacc atctacgacc tgggcaccaa gatgattgag tccctgacca aggacaaggt ccaggccggg gacgtgatca ccatcgacaa ggcgacgggc aagatctcca agctgggccg ctccttcaca cgcgcccgcg actacgacgc tatgggctcc cagaccaagt tcgtgcagtg cccagatggg gagctccaga aacgcaagga ggtggtgcac accgtgtccc tgcacgagat cgacgtcatc aactctcgca cccagggctt cctggcgctc ttctcaggtg acacagggga gatcaagtca gaagtccgtg agcagatcaa tgccaaggtg gctgagtggc gcgaggaggg caaggcggag atcatccctg gagtgctgtt catcgacgag gtccacatgc tggacatcga gagcttctcc ttcctcaacc gggccctgga gagtgacatg gcgcctgtcc tgatcatggc caccaaccgt ggcatcacgc gaatccgggg caccagctac cagagccctc acggcatccc catagacctg ctggaccggc tgcttatcgt ctccaccacc ccctacagcg agaaagacac gaagcagatc ctccgcatcc ggtgcgagga agaagatgtg gagatgagtg aggacgccta cacggtgctg acccgcatcg ggctggagac gtcactgcgc tacgccatcc agctcatcac agctgccagc ttggtgtgcc ggaaacgcaa gggtacagaa gtgcaggtgg atgacatcaa gcgggtctac tcactcttcc tggacgagtc ccgctccacg cagtacatga aggagtacca ggacgccttc ctcttcaacg aactcaaagg cgagaccatg gacacctcct ga. It is sometimes possible for the material contained within the vial of "RUVBL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.