Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RTP3 cdna clone

RTP3 cDNA Clone

Gene Names
RTP3; LTM1; TMEM7; Z3CXXC3
Synonyms
RTP3; RTP3 cDNA Clone; RTP3 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCTGGGGACACAGAAGTGTGGAAGCAAATGTTTCAGGAGTTAATGCGGGAGGTGAAGCCATGGCACAGGTGGACCCTGAGACCAGACAAGGGCCTTCTTCCCAACGTCCTGAAGCCAGGCTGGATGCAATACCAGCAGTGGACCTTCGCCAGGTTCCAGTGCTCCTCCTGCTCTCGTAACTGGGCCTCTGCCCAAGTTCTGGTCCTTTTCCACATGAACTGGAGTGAGGAGAAGTCCAGGGGCCAGGTGAAGATGAGGGTGTTTACCCAGAGATGTAAGAAGTGCCCCCAACCTCTGTTTGAGGACCCTGAGTTCACACAAGAGAACATCTCAAGGATCCTGAAAAACCTGGTGTTCCGAATTCTGAAGAAATGCTATAGAGGAAGATTTCAGTTGATAGAGGAGGTTCCTATGATCAAGGACATCTCTCTTGAAGGGCCACACAATAGTGACAACTGTGAGGCATGTCTGCAGGGCTTCTGTGCTGGGCCCATACAGGTTACAAGCCTCCCCCCATCTCAGACCCCAAGAGTACACTCCATTTACAAGGTGGAGGAGGTAGTTAAGCCCTGGGCCTCAGGAGAGAATGTCTATTCCTACGCATGCCAAAACCACATCTGTAGGAACTTAAGCATTTTCTGCTGTTGTGTCATTCTCATTGTTATCGTGGTGATTGTTGTAAAAACTGCTATATGA
Sequence Length
699
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,031 Da
NCBI Official Full Name
Homo sapiens receptor (chemosensory) transporter protein 3, mRNA
NCBI Official Synonym Full Names
receptor transporter protein 3
NCBI Official Symbol
RTP3
NCBI Official Synonym Symbols
LTM1; TMEM7; Z3CXXC3
NCBI Protein Information
receptor-transporting protein 3
UniProt Protein Name
Receptor-transporting protein 3
UniProt Gene Name
RTP3
UniProt Synonym Gene Names
TMEM7; Z3CXXC3
UniProt Entry Name
RTP3_HUMAN

Uniprot Description

RTP3: Belongs to the TMEM7 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cytoplasm

Molecular Function: olfactory receptor binding; protein binding

Biological Process: detection of chemical stimulus involved in sensory perception of bitter taste; protein insertion into membrane; protein targeting to membrane

Research Articles on RTP3

Similar Products

Product Notes

The RTP3 rtp3 (Catalog #AAA1276412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCTGGGG ACACAGAAGT GTGGAAGCAA ATGTTTCAGG AGTTAATGCG GGAGGTGAAG CCATGGCACA GGTGGACCCT GAGACCAGAC AAGGGCCTTC TTCCCAACGT CCTGAAGCCA GGCTGGATGC AATACCAGCA GTGGACCTTC GCCAGGTTCC AGTGCTCCTC CTGCTCTCGT AACTGGGCCT CTGCCCAAGT TCTGGTCCTT TTCCACATGA ACTGGAGTGA GGAGAAGTCC AGGGGCCAGG TGAAGATGAG GGTGTTTACC CAGAGATGTA AGAAGTGCCC CCAACCTCTG TTTGAGGACC CTGAGTTCAC ACAAGAGAAC ATCTCAAGGA TCCTGAAAAA CCTGGTGTTC CGAATTCTGA AGAAATGCTA TAGAGGAAGA TTTCAGTTGA TAGAGGAGGT TCCTATGATC AAGGACATCT CTCTTGAAGG GCCACACAAT AGTGACAACT GTGAGGCATG TCTGCAGGGC TTCTGTGCTG GGCCCATACA GGTTACAAGC CTCCCCCCAT CTCAGACCCC AAGAGTACAC TCCATTTACA AGGTGGAGGA GGTAGTTAAG CCCTGGGCCT CAGGAGAGAA TGTCTATTCC TACGCATGCC AAAACCACAT CTGTAGGAAC TTAAGCATTT TCTGCTGTTG TGTCATTCTC ATTGTTATCG TGGTGATTGT TGTAAAAACT GCTATATGA. It is sometimes possible for the material contained within the vial of "RTP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.