Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS6KA1 cdna clone

RPS6KA1 cDNA Clone

Gene Names
RPS6KA1; RSK; HU-1; RSK1; p90Rsk; MAPKAPK1A
Synonyms
RPS6KA1; RPS6KA1 cDNA Clone; RPS6KA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgctcgcccagctcaaggagccctggccgctcatggagctagtgccgctggacccggagaatggacagacctcaggggaagaagctggacttcagccgtccaaggatgagggcgtcctcaaggagatctccatcacgcaccacgtcaaggctggctctgagaaggctgatccatcccatttcgagctcctcaaggttctgggccagggatcctttggcaaagtcttcctggtgcggaaagtcacccggcctgacagtgggcacctgtatgctatgaaggtgctgaagaaggcaacgctgaaagtacgtgaccgcgtccggaccaagatggagagagacatcctggctgatgtaaatcacccattcgtggtgaagctgcactatgccttccagaccgagggcaagctctatctcattctggacttcctgcgtggtggggacctcttcacccggctctcaaaagaggtgatgttcacggaggaggatgtgaagttttacctggccgagctggctctgggcctggatcacctgcacagcctgggtatcatttacagagacctcaagcctgagaacatccttctggatgaggagggccacatcaaactcactgactttggcctgagcaaagaggccattgaccacgagaagaaggcctattctttctgcgggacagtggagtacatggcccctgaggtcgtcaaccgccagggccactcccatagtgcggactggtggtcctatggggtgttgatgtttgagatgctgacgggctccctgcccttccaggggaaggaccggaaggagaccatgacactgattctgaaggcgaagctaggcatgccccagtttctgagcactgaagcccagagcctcttgcgggccctgttcaagcggaatcctgccaaccggctcggctccggccctgatggggcagaggaaatcaagcggcatgtcttctactccaccattgactggaataagctataccgtcgtgagatcaagccacccttcaagccagcagtggctcagcctgatgacaccttctactttgacaccgagttcacgtcccgcacacccaaggattccccaggcatcccccccagcgctggggcccatcagctgttccggggcttcagcttcgtggccaccggcctgatggaagacgacggcaagcctcgtgccccgcaggcacccctgcactcggtggtacagcaactccatgggaagaacctggtttttagtgacggctacgtggtaaaggagacaattggtgtgggctcctactctgagtgcaagcgctgtgtccacaaggccaccaacatggagtatgctgtcaaggtcattgataagagcaagcgggatccttcagaagagattgagattcttctgcggtatggccagcaccccaacatcatcactctgaaagatgtgtatgatgatggcaaacacgtgtacctggtgacagagctgatgcggggtggggagctgctggacaagatcctgcggcagaagttcttctcagagcgggaggccagctttgtcctgcacaccattggcaaaactgtggagtatctgcactcacagggggttgtgcacagggacctgaagcccagcaacatcctgtatgtggacgagtccgggaatcccgagtgcctgcgcatctgtgactttggttttgccaaacagctgcgggctgagaatgggctcctcatgacaccttgctacacagccaactttgtggcgcctgaggtgctgaagcgccagggctacgatgaaggctgcgacatctggagcctgggcattctgctgtacaccatgctggcaggatatactccatttgccaacggtcccagtgacacaccagaggaaatcctaacccggatcggcagtgggaagtttaccctcagtgggggaaattggaacacagtttcagagacagccaaggacctggtgtccaagatgctacacgtggatccccaccagcgcctcacagctaagcaggttctgcagcatccatgggtcacccagaaagacaagcttccccaaagccagctgtcccaccaggacctacagcttgtgaagggagccatggctgccacgtactccgcactcaacagctccaagcccaccccccagctgaagcccatcgagtcatccatcctggcccagcggcgagtgaggaagttgccatccaccaccctgtga
Sequence Length
2208
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,147 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 1, mRNA
NCBI Official Synonym Full Names
ribosomal protein S6 kinase A1
NCBI Official Symbol
RPS6KA1
NCBI Official Synonym Symbols
RSK; HU-1; RSK1; p90Rsk; MAPKAPK1A
NCBI Protein Information
ribosomal protein S6 kinase alpha-1
UniProt Protein Name
Ribosomal protein S6 kinase alpha-1
UniProt Gene Name
RPS6KA1
UniProt Synonym Gene Names
MAPKAPK1A; RSK1; S6K-alpha-1; p90-RSK 1; p90RSK1; p90S6K; MAPK-activated protein kinase 1a; MAPKAP kinase 1a; MAPKAPK-1a; RSK-1
UniProt Entry Name
KS6A1_HUMAN

NCBI Description

This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 nonidentical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

p90RSK: an AGC kinase of the RSK family. Phosphorylated and activated by Erk1 and -2 in response to many growth factors, polypeptide hormones and neurotransmitters. Several phosphorylation sites are important for its activation. Possesses two kinase domains connected by a regulator linker region. Phosphorylates a wide range of substrates including ribosomal protein S6. Prominently expressed in brain structures essential for cognitive function and learning.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; Protein kinase, AGC; Translation; AGC group; RSK family; RSK subfamily

Chromosomal Location of Human Ortholog: 1p

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: caspase inhibitor activity; kinase activity; protein binding; protein serine/threonine kinase activity; protein serine/threonine/tyrosine kinase activity

Biological Process: negative regulation of apoptosis; negative regulation of caspase activity; positive regulation of cell differentiation; positive regulation of cell growth; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription in response to stress; regulation of translation in response to stress; signal transduction

Research Articles on RPS6KA1

Similar Products

Product Notes

The RPS6KA1 rps6ka1 (Catalog #AAA1274111) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctcg cccagctcaa ggagccctgg ccgctcatgg agctagtgcc gctggacccg gagaatggac agacctcagg ggaagaagct ggacttcagc cgtccaagga tgagggcgtc ctcaaggaga tctccatcac gcaccacgtc aaggctggct ctgagaaggc tgatccatcc catttcgagc tcctcaaggt tctgggccag ggatcctttg gcaaagtctt cctggtgcgg aaagtcaccc ggcctgacag tgggcacctg tatgctatga aggtgctgaa gaaggcaacg ctgaaagtac gtgaccgcgt ccggaccaag atggagagag acatcctggc tgatgtaaat cacccattcg tggtgaagct gcactatgcc ttccagaccg agggcaagct ctatctcatt ctggacttcc tgcgtggtgg ggacctcttc acccggctct caaaagaggt gatgttcacg gaggaggatg tgaagtttta cctggccgag ctggctctgg gcctggatca cctgcacagc ctgggtatca tttacagaga cctcaagcct gagaacatcc ttctggatga ggagggccac atcaaactca ctgactttgg cctgagcaaa gaggccattg accacgagaa gaaggcctat tctttctgcg ggacagtgga gtacatggcc cctgaggtcg tcaaccgcca gggccactcc catagtgcgg actggtggtc ctatggggtg ttgatgtttg agatgctgac gggctccctg cccttccagg ggaaggaccg gaaggagacc atgacactga ttctgaaggc gaagctaggc atgccccagt ttctgagcac tgaagcccag agcctcttgc gggccctgtt caagcggaat cctgccaacc ggctcggctc cggccctgat ggggcagagg aaatcaagcg gcatgtcttc tactccacca ttgactggaa taagctatac cgtcgtgaga tcaagccacc cttcaagcca gcagtggctc agcctgatga caccttctac tttgacaccg agttcacgtc ccgcacaccc aaggattccc caggcatccc ccccagcgct ggggcccatc agctgttccg gggcttcagc ttcgtggcca ccggcctgat ggaagacgac ggcaagcctc gtgccccgca ggcacccctg cactcggtgg tacagcaact ccatgggaag aacctggttt ttagtgacgg ctacgtggta aaggagacaa ttggtgtggg ctcctactct gagtgcaagc gctgtgtcca caaggccacc aacatggagt atgctgtcaa ggtcattgat aagagcaagc gggatccttc agaagagatt gagattcttc tgcggtatgg ccagcacccc aacatcatca ctctgaaaga tgtgtatgat gatggcaaac acgtgtacct ggtgacagag ctgatgcggg gtggggagct gctggacaag atcctgcggc agaagttctt ctcagagcgg gaggccagct ttgtcctgca caccattggc aaaactgtgg agtatctgca ctcacagggg gttgtgcaca gggacctgaa gcccagcaac atcctgtatg tggacgagtc cgggaatccc gagtgcctgc gcatctgtga ctttggtttt gccaaacagc tgcgggctga gaatgggctc ctcatgacac cttgctacac agccaacttt gtggcgcctg aggtgctgaa gcgccagggc tacgatgaag gctgcgacat ctggagcctg ggcattctgc tgtacaccat gctggcagga tatactccat ttgccaacgg tcccagtgac acaccagagg aaatcctaac ccggatcggc agtgggaagt ttaccctcag tgggggaaat tggaacacag tttcagagac agccaaggac ctggtgtcca agatgctaca cgtggatccc caccagcgcc tcacagctaa gcaggttctg cagcatccat gggtcaccca gaaagacaag cttccccaaa gccagctgtc ccaccaggac ctacagcttg tgaagggagc catggctgcc acgtactccg cactcaacag ctccaagccc accccccagc tgaagcccat cgagtcatcc atcctggccc agcggcgagt gaggaagttg ccatccacca ccctgtga. It is sometimes possible for the material contained within the vial of "RPS6KA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.