Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS15 cdna clone

RPS15 cDNA Clone

Gene Names
RPS15; RIG; S15
Synonyms
RPS15; RPS15 cDNA Clone; RPS15 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTCACCTACCGCGGCGTGGACCTCGACCAGCTGCTGGACATGTCCTACGAGCAGCTGATGCAGCTGTACAGTGCGCGCCAGCGGCGGCGGCTGAACCGGGGCCTGCGGCGGAAGCAGCACTCCCTGCTGAAGCGCCTGCGCAAGGCCAAGAAGGAGGCGCCGCCCATGGAGAAGCCGGAAGTGGTGAAGACGCACCTGCGGGACATGATCATCCTACCCGAGATGGTGGGCAGCATGGTGGGCGTCTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAGCCCGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAGCCCGTAAAGCATGGCCGGCCCGGCATCGGGGCCACCCACTCCTCCCGCTTCATCCCTCTCAAGTAA
Sequence Length
438
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,040 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S15, mRNA
NCBI Official Synonym Full Names
ribosomal protein S15
NCBI Official Symbol
RPS15
NCBI Official Synonym Symbols
RIG; S15
NCBI Protein Information
40S ribosomal protein S15
UniProt Protein Name
40S ribosomal protein S15
Protein Family
UniProt Gene Name
RPS15
UniProt Synonym Gene Names
RIG
UniProt Entry Name
RS15_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S19P family of ribosomal proteins. It is located in the cytoplasm. This gene has been found to be activated in various tumors, such as insulinomas, esophageal cancers, and colon cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Uniprot Description

RPS15: a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S19P family of ribosomal proteins. It is located in the cytoplasm. This gene has been found to be activated in various tumors, such as insulinomas, esophageal cancers, and colon cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Protein type: Ribosomal; RNA-binding

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; cytosol; focal adhesion; membrane; nucleoplasm

Molecular Function: protein binding; structural constituent of ribosome

Biological Process: mRNA catabolic process, nonsense-mediated decay; osteoblast differentiation; ribosomal small subunit assembly and maintenance; ribosomal small subunit biogenesis and assembly; ribosomal small subunit export from nucleus; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translation; translational initiation; viral transcription

Research Articles on RPS15

Similar Products

Product Notes

The RPS15 rps15 (Catalog #AAA1265753) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCAGAAG TAGAGCAGAA GAAGAAGCGG ACCTTCCGCA AGTTCACCTA CCGCGGCGTG GACCTCGACC AGCTGCTGGA CATGTCCTAC GAGCAGCTGA TGCAGCTGTA CAGTGCGCGC CAGCGGCGGC GGCTGAACCG GGGCCTGCGG CGGAAGCAGC ACTCCCTGCT GAAGCGCCTG CGCAAGGCCA AGAAGGAGGC GCCGCCCATG GAGAAGCCGG AAGTGGTGAA GACGCACCTG CGGGACATGA TCATCCTACC CGAGATGGTG GGCAGCATGG TGGGCGTCTA CAACGGCAAG ACCTTCAACC AGGTGGAGAT CAAGCCCGAG ATGATCGGCC ACTACCTGGG CGAGTTCTCC ATCACCTACA AGCCCGTAAA GCATGGCCGG CCCGGCATCG GGGCCACCCA CTCCTCCCGC TTCATCCCTC TCAAGTAA. It is sometimes possible for the material contained within the vial of "RPS15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.