Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS11 cdna clone

RPS11 cDNA Clone

Gene Names
RPS11; S11
Synonyms
RPS11; RPS11 cDNA Clone; RPS11 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacattcagactgagcgtgcctaccaaaagcagccgaccatctttcaaaacaagaagagggtcctgctgggagaaactggcaaggagaagctcccgcggtactacaagaacatcggtctgggcttcaagacacccaaggaggctattgagggcacctacattgacaagaaatgccccttcactggtaatgtgtccattcgagggcggatcctctctggcgtggtgaccaagatgaagatgcagaggaccattgtcatccgccgagactatctgcactacatccgcaagtacaaccgcttcgagaagcgccacaagaacatgtctgtacacctgtccccctgcttcagggacgtccagatcggtgacatcgtcacagtgggcgagtgccggcctctgagcaagacagtgcgcttcaacgtgctcaaggtcaccaaggctgccggcaccaagaagcagttccagaagttctga
Sequence Length
477
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,431 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S11, mRNA
NCBI Official Synonym Full Names
ribosomal protein S11
NCBI Official Symbol
RPS11
NCBI Official Synonym Symbols
S11
NCBI Protein Information
40S ribosomal protein S11
UniProt Protein Name
40S ribosomal protein S11
Protein Family
UniProt Gene Name
RPS11
UniProt Entry Name
RS11_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S17P family of ribosomal proteins that is a component of the 40S subunit. This gene is co-transcribed with the small nucleolar RNA gene U35B, which is located in the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]

Uniprot Description

RPS11: a member of the S17P family of ribosomal proteins that is a component of the 40S subunit. This gene is co-transcribed with the small nucleolar RNA gene U35B, which is located in the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]

Protein type: RNA-binding; Ribosomal; Translation

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: cytoplasm; cytosol; extracellular matrix; focal adhesion; membrane; nucleolus; nucleoplasm

Molecular Function: protein binding; structural constituent of ribosome

Biological Process: mRNA catabolic process, nonsense-mediated decay; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translation; translational initiation; viral transcription

Research Articles on RPS11

Similar Products

Product Notes

The RPS11 rps11 (Catalog #AAA1273655) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaca ttcagactga gcgtgcctac caaaagcagc cgaccatctt tcaaaacaag aagagggtcc tgctgggaga aactggcaag gagaagctcc cgcggtacta caagaacatc ggtctgggct tcaagacacc caaggaggct attgagggca cctacattga caagaaatgc cccttcactg gtaatgtgtc cattcgaggg cggatcctct ctggcgtggt gaccaagatg aagatgcaga ggaccattgt catccgccga gactatctgc actacatccg caagtacaac cgcttcgaga agcgccacaa gaacatgtct gtacacctgt ccccctgctt cagggacgtc cagatcggtg acatcgtcac agtgggcgag tgccggcctc tgagcaagac agtgcgcttc aacgtgctca aggtcaccaa ggctgccggc accaagaagc agttccagaa gttctga. It is sometimes possible for the material contained within the vial of "RPS11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.