Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPLP1 cdna clone

RPLP1 cDNA Clone

Gene Names
RPLP1; P1; LP1; RPP1
Synonyms
RPLP1; RPLP1 cDNA Clone; RPLP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcctcatctgcaatgtaggggccggtggacctgctccagcagctggtgctgcaccagcaggaggtcctgccccctccactgctgctgctccagctgaggagaagaaagtggaagcaaagaaagaagaatccgaggagtctgatgatgacatgggctttggtctttttgactaa
Sequence Length
345
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,804 Da
NCBI Official Full Name
Homo sapiens ribosomal protein, large, P1, mRNA
NCBI Official Synonym Full Names
ribosomal protein lateral stalk subunit P1
NCBI Official Symbol
RPLP1
NCBI Official Synonym Symbols
P1; LP1; RPP1
NCBI Protein Information
60S acidic ribosomal protein P1
UniProt Protein Name
60S acidic ribosomal protein P1
UniProt Gene Name
RPLP1
UniProt Synonym Gene Names
RRP1
UniProt Entry Name
RLA1_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Uniprot Description

RPLP1: Plays an important role in the elongation step of protein synthesis. Belongs to the ribosomal protein L12P family.

Protein type: Ribosomal; Translation

Chromosomal Location of Human Ortholog: 15q22

Cellular Component: cytoplasm; cytosol; focal adhesion

Molecular Function: protein binding; protein kinase activator activity; structural constituent of ribosome

Biological Process: mRNA catabolic process, nonsense-mediated decay; positive regulation of protein kinase activity; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translational initiation; viral transcription

Research Articles on RPLP1

Similar Products

Product Notes

The RPLP1 rplp1 (Catalog #AAA1271610) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctctg tctccgagct cgcctgcatc tactcggccc tcattctgca cgacgatgag gtgacagtca cggaggataa gatcaatgcc ctcattaaag cagccggtgt aaatgttgag cctttttggc ctggcttgtt tgcaaaggcc ctggccaacg tcaacattgg gagcctcatc tgcaatgtag gggccggtgg acctgctcca gcagctggtg ctgcaccagc aggaggtcct gccccctcca ctgctgctgc tccagctgag gagaagaaag tggaagcaaa gaaagaagaa tccgaggagt ctgatgatga catgggcttt ggtctttttg actaa. It is sometimes possible for the material contained within the vial of "RPLP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.