Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPL35A cdna clone

RPL35A cDNA Clone

Synonyms
RPL35A; RPL35A cDNA Clone; RPL35A cdna clone
Ordering
For Research Use Only!
Sequence
atgtctggaaggctgtggtccaaggccatttttgctggctataagcggggtctccggaaccaaagggagcacacagctcttcttaaaattgaaggtgtttacgcccgagatgaaacagaattctatttgggcaagagatgcgcttatgtatataaagcaaagaacaacacagtcactcctggcggcaaaccaaacaaaaccagagtcatctggggaaaagtaactcgggcccatggaaacagtggcatggttcgtgccaaattccgaagcaatcttcctgctaaggccattggacacagaatccgagtgatgctgtacccctcaaggatttaa
Sequence Length
333
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,538 Da
NCBI Official Full Name
Homo sapiens ribosomal protein L35a, mRNA
UniProt Protein Name
60S ribosomal protein L35a
Protein Family
UniProt Gene Name
RPL35A
UniProt Entry Name
RL35A_HUMAN

Uniprot Description

RPL35A: Required for the proliferation and viability of hematopoietic cells. Plays a role in 60S ribosomal subunit formation. The protein was found to bind to both initiator and elongator tRNAs and consequently was assigned to the P site or P and A site. Defects in RPL35A are the cause of Diamond-Blackfan anemia type 5 (DBA5). DBA5 is a form of Diamond- Blackfan anemia, a congenital non-regenerative hypoplastic anemia that usually presents early in infancy. Diamond-Blackfan anemia is characterized by a moderate to severe macrocytic anemia, erythroblastopenia, and an increased risk of malignancy. 30 to 40% of Diamond-Blackfan anemia patients present with short stature and congenital anomalies, the most frequent being craniofacial (Pierre-Robin syndrome and cleft palate), thumb and urogenital anomalies. Belongs to the ribosomal protein L35Ae family.

Protein type: Translation; Ribosomal; RNA-binding

Chromosomal Location of Human Ortholog: 3q29

Cellular Component: cytosol; extracellular matrix; membrane

Molecular Function: protein binding; structural constituent of ribosome

Biological Process: mRNA catabolic process, nonsense-mediated decay; ribosomal large subunit biogenesis and assembly; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translational initiation; viral transcription

Disease: Diamond-blackfan Anemia 5

Similar Products

Product Notes

The RPL35A rpl35a (Catalog #AAA1267294) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctggaa ggctgtggtc caaggccatt tttgctggct ataagcgggg tctccggaac caaagggagc acacagctct tcttaaaatt gaaggtgttt acgcccgaga tgaaacagaa ttctatttgg gcaagagatg cgcttatgta tataaagcaa agaacaacac agtcactcct ggcggcaaac caaacaaaac cagagtcatc tggggaaaag taactcgggc ccatggaaac agtggcatgg ttcgtgccaa attccgaagc aatcttcctg ctaaggccat tggacacaga atccgagtga tgctgtaccc ctcaaggatt taa. It is sometimes possible for the material contained within the vial of "RPL35A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.