Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPL35 cdna clone

RPL35 cDNA Clone

Gene Names
RPL35; L35
Synonyms
RPL35; RPL35 cDNA Clone; RPL35 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaagatcaaggctcgagatcttcgcgggaagaagaaggaggagctgctgaaacagctggacgacctgaaggtggagctgtcccagctgcgcgtcgccaaagtgacaggcggtgcggcctccaagctctctaagatccgagtcgtccggaaatccattgcccgtgttctcacagttattaaccagactcagaaagaaaacctcaggaaattctacaagggcaagaagtacaagcccctggacctgcggcctaagaagacacgtgccatgcgccgccggctcaacaagcacgaggagaacctgaagaccaagaagcagcagcggaaggagcggctgtacccgctgcggaagtacgcggtcagggcctga
Sequence Length
372
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,551 Da
NCBI Official Full Name
Homo sapiens ribosomal protein L35, mRNA
NCBI Official Synonym Full Names
ribosomal protein L35
NCBI Official Symbol
RPL35
NCBI Official Synonym Symbols
L35
NCBI Protein Information
60S ribosomal protein L35
UniProt Protein Name
60S ribosomal protein L35
Protein Family
UniProt Gene Name
RPL35
UniProt Entry Name
RL35_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Uniprot Description

RPL35: a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Protein type: Translation; Ribosomal

Chromosomal Location of Human Ortholog: 9q34.1

Cellular Component: cytoplasm; cytosol; membrane; nucleolus

Molecular Function: mRNA binding

Biological Process: maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); mRNA catabolic process, nonsense-mediated decay; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translational initiation; viral transcription

Research Articles on RPL35

Similar Products

Product Notes

The RPL35 rpl35 (Catalog #AAA1266352) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaaga tcaaggctcg agatcttcgc gggaagaaga aggaggagct gctgaaacag ctggacgacc tgaaggtgga gctgtcccag ctgcgcgtcg ccaaagtgac aggcggtgcg gcctccaagc tctctaagat ccgagtcgtc cggaaatcca ttgcccgtgt tctcacagtt attaaccaga ctcagaaaga aaacctcagg aaattctaca agggcaagaa gtacaagccc ctggacctgc ggcctaagaa gacacgtgcc atgcgccgcc ggctcaacaa gcacgaggag aacctgaaga ccaagaagca gcagcggaag gagcggctgt acccgctgcg gaagtacgcg gtcagggcct ga. It is sometimes possible for the material contained within the vial of "RPL35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.