Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPL31 cdna clone

RPL31 cDNA Clone

Gene Names
RPL31; L31
Synonyms
RPL31; RPL31 cDNA Clone; RPL31 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcccgcaaagaagggtggcgagaagaaaaagggccgttctgccatcaacgaagtggtaacccgagaatacaccatcaacattcacaagcgcatccatggagtgggcttcaagaagcgtgcacctcgggcactcaaagagattcggaaatttgccatgaaggagatgggaactccagatgtgcgcattgacaccaggctcaacaaagctgtctgggccaaaggaataaggaatgtgccataccgaatccgtgtgcggctgtccagaaaacgtaatgaggatgaagattcaccaaataagctatatactttggttacctatgtacctgttaccactttcaaaaatctacagacagtcaatgtggatgagaactaa
Sequence Length
378
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,995 Da
NCBI Official Full Name
Homo sapiens ribosomal protein L31, mRNA
NCBI Official Synonym Full Names
ribosomal protein L31
NCBI Official Symbol
RPL31
NCBI Official Synonym Symbols
L31
NCBI Protein Information
60S ribosomal protein L31
UniProt Protein Name
60S ribosomal protein L31
UniProt Gene Name
RPL31
UniProt Entry Name
RL31_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Research Articles on RPL31

Similar Products

Product Notes

The RPL31 rpl31 (Catalog #AAA1278210) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcccg caaagaaggg tggcgagaag aaaaagggcc gttctgccat caacgaagtg gtaacccgag aatacaccat caacattcac aagcgcatcc atggagtggg cttcaagaag cgtgcacctc gggcactcaa agagattcgg aaatttgcca tgaaggagat gggaactcca gatgtgcgca ttgacaccag gctcaacaaa gctgtctggg ccaaaggaat aaggaatgtg ccataccgaa tccgtgtgcg gctgtccaga aaacgtaatg aggatgaaga ttcaccaaat aagctatata ctttggttac ctatgtacct gttaccactt tcaaaaatct acagacagtc aatgtggatg agaactaa. It is sometimes possible for the material contained within the vial of "RPL31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.