Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPL14 cdna clone

RPL14 cDNA Clone

Gene Names
RPL14; L14; RL14; hRL14; CTG-B33; CAG-ISL-7
Synonyms
RPL14; RPL14 cDNA Clone; RPL14 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgttcaggcgcttcgtggaggttggccgggtggcctatgtctcctttggacctcatgccggaaaattggtcgcgattgtagatgttattgatcagaacagggctttggtcgatggaccttgcactcaagtgaggagacaggccatgcctttcaagtgcatgcagctcactgatttcatcctcaagtttccgcacagtgcccaccagaagtatgtccgacaagcctggcagaaggcagacatcaatacaaaatgggcagccacacgatgggccaagaagattgaagccagagaaaggaaagccaagatgacagattttgatcgttttaaagttatgaaggcaaagaaaatgaggaacagaataatcaagaatgaagttaagaagcttcaaaaggcagctctcctgaaagcttctcccaaaaaagcacctggtactaagggtactgctgctgctgctgctgctgctgctgctgctgctgctgctgctaaagttccagcaaaaaagatcaccgccgcgagtaaaaaggctccagcccagaaggttcctgcccagaaagccacaggccagaaagcagcgcctgctccaaaagctcagaagggtcaaaaagctccagcccagaaagcacctgctccaaaggcatctggcaagaaagcataa
Sequence Length
660
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,432 Da
NCBI Official Full Name
Homo sapiens ribosomal protein L14, mRNA
NCBI Official Synonym Full Names
ribosomal protein L14
NCBI Official Symbol
RPL14
NCBI Official Synonym Symbols
L14; RL14; hRL14; CTG-B33; CAG-ISL-7
NCBI Protein Information
60S ribosomal protein L14
UniProt Protein Name
60S ribosomal protein L14
Protein Family
UniProt Gene Name
RPL14
UniProt Entry Name
RL14_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Uniprot Description

RPL14: a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Protein type: Translation; Ribosomal

Chromosomal Location of Human Ortholog: 3p22-p21.2

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; membrane

Molecular Function: protein binding; RNA binding

Biological Process: mRNA catabolic process, nonsense-mediated decay; ribosomal large subunit biogenesis and assembly; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translational initiation; viral transcription

Similar Products

Product Notes

The RPL14 rpl14 (Catalog #AAA1267796) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgttca ggcgcttcgt ggaggttggc cgggtggcct atgtctcctt tggacctcat gccggaaaat tggtcgcgat tgtagatgtt attgatcaga acagggcttt ggtcgatgga ccttgcactc aagtgaggag acaggccatg cctttcaagt gcatgcagct cactgatttc atcctcaagt ttccgcacag tgcccaccag aagtatgtcc gacaagcctg gcagaaggca gacatcaata caaaatgggc agccacacga tgggccaaga agattgaagc cagagaaagg aaagccaaga tgacagattt tgatcgtttt aaagttatga aggcaaagaa aatgaggaac agaataatca agaatgaagt taagaagctt caaaaggcag ctctcctgaa agcttctccc aaaaaagcac ctggtactaa gggtactgct gctgctgctg ctgctgctgc tgctgctgct gctgctgcta aagttccagc aaaaaagatc accgccgcga gtaaaaaggc tccagcccag aaggttcctg cccagaaagc cacaggccag aaagcagcgc ctgctccaaa agctcagaag ggtcaaaaag ctccagccca gaaagcacct gctccaaagg catctggcaa gaaagcataa. It is sometimes possible for the material contained within the vial of "RPL14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.