Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPL12 cdna clone

RPL12

Gene Names
RPL12; L12
Synonyms
RPL12; L12; RPL12 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGTATACCTGAGGTGCACCGGAGGTGAAGTCGGTGCCACTTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTCTGTCTCCAAAAAAAGTTGGTGATGACATTGCCAAGGCAACGGGTGACTGGAAGGGCCTGAGGATTACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGATTGAGGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGAAACAGAAAAACATTAAACACAGTGGGAATATCACTTTTGATGAGATTGTCAACATTGCTCGACAGATGCGGCACCGATCCTTAGCCAGAGAACTCTCTGGAACCATTAAAGAGATCCTGGGGACTGCCCAGTCAGTGGGCTGTAATGTTGATGGCCGCCATCCTCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAATGCCCAGCCAGTTAA

Translation Sequence: MPPKFDPNEI KVVYLRCTGG EVGATSALAP KIGPLGLSPK KVGDDIAKAT GDWKGLRITV KLTIQNRQAQ IEVVPSASAL IIKALKEPPR DRKKQKNIKH SGNITFDEIV NIARQMRHRS LARELSGTIK EILGTAQSVG CNVDGRHPHD IIDDINSGAV ECPAS
Sequence Length
165
Species
Human
Chromosome Location
9q34
OMIM Reference Number
180475
cDNA Size
498bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for RPL12 cdna clone
RPS12 is a ribosomal protein that is a component of the 60S subunit and belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron.
Product Categories/Family for RPL12 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
60S ribosomal protein L12
NCBI Official Synonym Full Names
ribosomal protein L12
NCBI Official Symbol
RPL12
NCBI Official Synonym Symbols
L12
NCBI Protein Information
60S ribosomal protein L12
UniProt Protein Name
60S ribosomal protein L12
Protein Family
UniProt Gene Name
RPL12
UniProt Entry Name
RL12_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. The protein binds directly to the 26S rRNA. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Uniprot Description

RPL12: a ribosomal protein of the L11P family. Located in the cytoplasm. Binds directly to the 26S rRNA. Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This protein is a component of the 60S subunit.

Protein type: Translation; Ribosomal

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: focal adhesion; membrane; cytosol

Molecular Function: protein binding; structural constituent of ribosome

Biological Process: SRP-dependent cotranslational protein targeting to membrane; translational elongation; cellular protein metabolic process; translation; viral reproduction; translational initiation; mRNA catabolic process, nonsense-mediated decay; viral transcription; gene expression; viral infectious cycle; translational termination

Research Articles on RPL12

Similar Products

Product Notes

The RPL12 rpl12 (Catalog #AAA200916) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGCCGCCGA AGTTCGACCC CAACGAGATC AAAGTCGTAT ACCTGAGGTG CACCGGAGGT GAAGTCGGTG CCACTTCTGC CCTGGCCCCC AAGATCGGCC CCCTGGGTCT GTCTCCAAAA AAAGTTGGTG ATGACATTGC CAAGGCAACG GGTGACTGGA AGGGCCTGAG GATTACAGTG AAACTGACCA TTCAGAACAG ACAGGCCCAG ATTGAGGTGG TGCCTTCTGC CTCTGCCCTG ATCATCAAAG CCCTCAAGGA ACCACCAAGA GACAGAAAGA AACAGAAAAA CATTAAACAC AGTGGGAATA TCACTTTTGA TGAGATTGTC AACATTGCTC GACAGATGCG GCACCGATCC TTAGCCAGAG AACTCTCTGG AACCATTAAA GAGATCCTGG GGACTGCCCA GTCAGTGGGC TGTAATGTTG ATGGCCGCCA TCCTCATGAC ATCATCGATG ACATCAACAG TGGTGCTGTG GAATGCCCAG CCAGTTAA Tran slation Sequence: MPPKFDPNEI KVVYLRCTGG EVGATSALAP KIGPLGLSPK KVGDDIAKAT GDWKGLRITV KLTIQNRQAQ IEVVPSASAL IIKALKEPPR DRKKQKNIKH SGNITFDEIV NIARQMRHRS LARELSGTIK EILGTAQSVG CNVDGRHPHD IIDDINSGAV ECPAS. It is sometimes possible for the material contained within the vial of "RPL12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.