ROPN1B cdna clone
ROPN1B cDNA Clone
Synonyms
ROPN1B; ROPN1B cDNA Clone; ROPN1B cdna clone
Sequence
atgtggaaagtggtgaatctcccaacagatctgtttaatagtgtgatgaatgtgggtcgcttcacggaggagatcgagtggctgaagtttttagcccttgcttgcagcgctctgggagttactattaccaaaactctcaagatagtgtgtgaggtcttatcatgtgaccacaatggtgggttgccccgaatcccattcagcaccttccagtttctctacacgtatattgccgaagtggatggggagatctgtgcatcacatgtcagcaggatgctaaactacattgaacaggaagtaattggtcctgatggtttaatcacggtgaatgactttacccaaaaccccagggtttggctggagtaa
Sequence Length
363
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,587 Da
NCBI Official Full Name
Homo sapiens ropporin, rhophilin associated protein 1B, mRNA
NCBI Official Synonym Full Names
rhophilin associated tail protein 1B
NCBI Official Symbol
ROPN1B
NCBI Protein Information
ropporin-1B
UniProt Protein Name
Ropporin-1B
Protein Family
UniProt Gene Name
ROPN1B
UniProt Entry Name
ROP1B_HUMAN
Uniprot Description
ROPN1B: Belongs to the ropporin family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 3q21.2
Cellular Component: cytoplasm
Molecular Function: protein binding; protein heterodimerization activity
Biological Process: Rho protein signal transduction; sperm motility
Similar Products
Product Notes
The ROPN1B ropn1b (Catalog #AAA1273308) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggaaag tggtgaatct cccaacagat ctgtttaata gtgtgatgaa tgtgggtcgc ttcacggagg agatcgagtg gctgaagttt ttagcccttg cttgcagcgc tctgggagtt actattacca aaactctcaa gatagtgtgt gaggtcttat catgtgacca caatggtggg ttgccccgaa tcccattcag caccttccag tttctctaca cgtatattgc cgaagtggat ggggagatct gtgcatcaca tgtcagcagg atgctaaact acattgaaca ggaagtaatt ggtcctgatg gtttaatcac ggtgaatgac tttacccaaa accccagggt ttggctggag taa. It is sometimes possible for the material contained within the vial of "ROPN1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
