RNFT1 cdna clone
RNFT1 cDNA Clone
Gene Names
RNFT1; PTD016
Synonyms
RNFT1; RNFT1 cDNA Clone; RNFT1 cdna clone
Sequence
atgcaagccaatcgtagccaactgcacagtcctccaggaaccggaagcagtgaggatgcctcaacccctcagtgtgtccacacaagattgacaggagagggttcttgccctcattctggagatgttcatatccagataaactccatacctaaagaatgtgcagaaaatgcaagctccagaaatataaggtcaggtgtccatagctgtgcccatggatgtgtacacagtcgcttacggggtcactcccacagtgaagcaaggctgactgatgatactgccgcagaatctggagatcatggtagtagctccttctcagaattccgctatctcttcaagtggctgcaaaaaagtcttccatatattttgattctgagcgtcaaacttgttatgcagcatataacaggaatttctcttggaattgggctgctaacaacttttatgtatgcaaacaaaagcattgtaaatcaggtttttctaagacttaatttttttaaatcctactttggaccatttgagcttctgggaagtattttggattgttggaattacagacttcattctgaaattctttttcatgggcttaaaatgccttattttattggtgccttctttcatcatgccttttaa
Sequence Length
627
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,302 Da
NCBI Official Full Name
Homo sapiens ring finger protein, transmembrane 1, mRNA
NCBI Official Synonym Full Names
ring finger protein, transmembrane 1
NCBI Official Symbol
RNFT1
NCBI Official Synonym Symbols
PTD016
NCBI Protein Information
RING finger and transmembrane domain-containing protein 1
UniProt Protein Name
RING finger and transmembrane domain-containing protein 1
Protein Family
UniProt Gene Name
RNFT1
UniProt Entry Name
RNFT1_HUMAN
Uniprot Description
RNFT1: 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Ubiquitin conjugating system; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 17q23.1
Research Articles on RNFT1
Similar Products
Product Notes
The RNFT1 rnft1 (Catalog #AAA1271526) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaagcca atcgtagcca actgcacagt cctccaggaa ccggaagcag tgaggatgcc tcaacccctc agtgtgtcca cacaagattg acaggagagg gttcttgccc tcattctgga gatgttcata tccagataaa ctccatacct aaagaatgtg cagaaaatgc aagctccaga aatataaggt caggtgtcca tagctgtgcc catggatgtg tacacagtcg cttacggggt cactcccaca gtgaagcaag gctgactgat gatactgccg cagaatctgg agatcatggt agtagctcct tctcagaatt ccgctatctc ttcaagtggc tgcaaaaaag tcttccatat attttgattc tgagcgtcaa acttgttatg cagcatataa caggaatttc tcttggaatt gggctgctaa caacttttat gtatgcaaac aaaagcattg taaatcaggt ttttctaaga cttaattttt ttaaatccta ctttggacca tttgagcttc tgggaagtat tttggattgt tggaattaca gacttcattc tgaaattctt tttcatgggc ttaaaatgcc ttattttatt ggtgccttct ttcatcatgc cttttaa. It is sometimes possible for the material contained within the vial of "RNFT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
