Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF32 cdna clone

RNF32 cDNA Clone

Gene Names
RNF32; HSD15; LMBR2; FKSG33
Synonyms
RNF32; RNF32 cDNA Clone; RNF32 cdna clone
Ordering
For Research Use Only!
Sequence
atgttaaaaaataagggtcactcatctaagaaagataacttggcagtcaatgcagttgctttacaagatcacattttacatgatcttcaacttcgaaatctttcagttgcagatcattctaagacacaagtacaaaagaaagagaacaaatctctaaaaagagatacaaaggcaataatagatactggacttaaaaaaactacacagtgccccaaactagaagactcagaaaaagaatatgttcttgatcccaaaccgccgccgttgactttggcacagaagttgggcctcattgggcctccaccacctccactgtcatcagatgaatgggagaaggtgaaacagcgctctctcctgcaaggggactccgtgcaaccatgccccatctgtaaagaagaattcgagcttcgtcctcaggtgctgctttcatgctcccatgtgttccacaaagcatgtcttcaggcttttgaaaagttcacaaataagaaaacctgtcctctctgtagaaagaaccagtatcaaacccgagtgatacacgatggggcccgcctgttcagaatcaagtgtgtgaccagaatccaagcctactggagaggatgtgttgttagaaagtggtacagaaacctgaggaaaacagtacctcccacagatgccaagttaagaaaaaaattctttgaaaaaaagacacaagactggaaaccagcttaa
Sequence Length
708
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,682 Da
NCBI Official Full Name
Homo sapiens ring finger protein 32, mRNA
NCBI Official Synonym Full Names
ring finger protein 32
NCBI Official Symbol
RNF32
NCBI Official Synonym Symbols
HSD15; LMBR2; FKSG33
NCBI Protein Information
RING finger protein 32
UniProt Protein Name
RING finger protein 32
Protein Family
UniProt Gene Name
RNF32
UniProt Entry Name
RNF32_HUMAN

NCBI Description

The protein encoded by this gene contains two RING ring finger motifs. RING finger motifs are present in a variety of functionally distinct proteins and are known to be involved in protein-DNA or protein-protein interactions. This gene was found to be expressed during spermatogenesis, most likely in spermatocytes and/or in spermatids. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Uniprot Description

RNF32: May play a role in sperm formation. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 7q36

Cellular Component: endosome

Molecular Function: protein binding

Research Articles on RNF32

Similar Products

Product Notes

The RNF32 rnf32 (Catalog #AAA1276005) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttaaaaa ataagggtca ctcatctaag aaagataact tggcagtcaa tgcagttgct ttacaagatc acattttaca tgatcttcaa cttcgaaatc tttcagttgc agatcattct aagacacaag tacaaaagaa agagaacaaa tctctaaaaa gagatacaaa ggcaataata gatactggac ttaaaaaaac tacacagtgc cccaaactag aagactcaga aaaagaatat gttcttgatc ccaaaccgcc gccgttgact ttggcacaga agttgggcct cattgggcct ccaccacctc cactgtcatc agatgaatgg gagaaggtga aacagcgctc tctcctgcaa ggggactccg tgcaaccatg ccccatctgt aaagaagaat tcgagcttcg tcctcaggtg ctgctttcat gctcccatgt gttccacaaa gcatgtcttc aggcttttga aaagttcaca aataagaaaa cctgtcctct ctgtagaaag aaccagtatc aaacccgagt gatacacgat ggggcccgcc tgttcagaat caagtgtgtg accagaatcc aagcctactg gagaggatgt gttgttagaa agtggtacag aaacctgagg aaaacagtac ctcccacaga tgccaagtta agaaaaaaat tctttgaaaa aaagacacaa gactggaaac cagcttaa. It is sometimes possible for the material contained within the vial of "RNF32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.