RNF26 cdna clone
RNF26 cDNA Clone
Synonyms
RNF26; RNF26 cDNA Clone; RNF26 cdna clone
Sequence
atggaggcagtgtacctggtagtgaatgggttgggcctggtgctggacgtgctgaccttggtgttggacctcaacttcctgctggtgtcctccctcctggcttccctggcctggctcctggccttcgtctacaacctgccgcacacggtactgactagtcttctgcacttgggccgcggagtcttgctttcattgctggccttgatcgaagccgtggtccggttcacatgtgggggcttgcaggccttgtgtactctgctgtatagctgctgctctggcctagagagcctaaagctcctggggcacctggcctctcatggggcactgcggagcagggagatactgcaccggggcgtcctcaatgtggtctccagtggccatgctttgctgcgccaggcctgtgacatctgtgccattgccatgagcctggtggcttatgtgatcaacagcctggtcaacatctgcctcatcggcactcagaacctcttttccctggtgctggccctgtgggatgcagtgaccgggcctctgtggaggatgacagacgtagtggctgccttcctagcccacatttccagcagtgctgtggccatggccatcctcctttggacaccctgccaactagccctggagctgctggcctcagctgcccgcctcctggccagctttgtgcttgtcaatctcactggcttggtgttgctagcttgtgtgctggcagtgacggtgactgtgttgcatccggacttcaccctgaggctggctacccaggcactcagccagctccatgcccggccatcctaccaccgtcttcgagaggatgtcatgcggctctctcgcctagcactgggctcagaggcctggcgccgagtctggagccgcagtctgcagctggcgagttggccaaaccggggaggggcacctggagctccccagggtgaccctatgagggtattctcagttaggacccggagacaggacactcttcctgaagcggggcgcagatcagaggcagaagaggaggaggccaggaccatcagagtgacacctgtcaggggccgagagaggctcaatgaggaggagcctccaggtgggcaagacccttggaaattgctgaaggagcaagaggagcggaagaagtgtgtcatctgccaggaccagagcaagacagtgttgctcctgccctgccggcatctgtgcctgtgccaggcctgcactgaaatcctgatgcgccaccccgtctaccaccgcaattgcccgctctgccgccggggcatcctgcagaccctcaatgtctacctctga
Sequence Length
1302
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,737 Da
NCBI Official Full Name
Homo sapiens ring finger protein 26, mRNA
NCBI Official Synonym Full Names
ring finger protein 26
NCBI Official Symbol
RNF26
NCBI Protein Information
RING finger protein 26
UniProt Protein Name
RING finger protein 26
Protein Family
UniProt Gene Name
RNF26
UniProt Entry Name
RNF26_HUMAN
NCBI Description
The protein encoded by this intronless gene contains a C3HC5 type of RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. The expression of this gene was found to be upregulated in cancer cell lines derived from different types of cancer. [provided by RefSeq, Jul 2008]
Uniprot Description
RNF26: RING finger protein 26. Contains a C3HC5 type of RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. The expression of this gene was found to be upregulated in cancer cell lines derived from different types of cancer.
Protein type: Ubiquitin conjugating system; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 11q23
Research Articles on RNF26
Similar Products
Product Notes
The RNF26 rnf26 (Catalog #AAA1265865) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcag tgtacctggt agtgaatggg ttgggcctgg tgctggacgt gctgaccttg gtgttggacc tcaacttcct gctggtgtcc tccctcctgg cttccctggc ctggctcctg gccttcgtct acaacctgcc gcacacggta ctgactagtc ttctgcactt gggccgcgga gtcttgcttt cattgctggc cttgatcgaa gccgtggtcc ggttcacatg tgggggcttg caggccttgt gtactctgct gtatagctgc tgctctggcc tagagagcct aaagctcctg gggcacctgg cctctcatgg ggcactgcgg agcagggaga tactgcaccg gggcgtcctc aatgtggtct ccagtggcca tgctttgctg cgccaggcct gtgacatctg tgccattgcc atgagcctgg tggcttatgt gatcaacagc ctggtcaaca tctgcctcat cggcactcag aacctctttt ccctggtgct ggccctgtgg gatgcagtga ccgggcctct gtggaggatg acagacgtag tggctgcctt cctagcccac atttccagca gtgctgtggc catggccatc ctcctttgga caccctgcca actagccctg gagctgctgg cctcagctgc ccgcctcctg gccagctttg tgcttgtcaa tctcactggc ttggtgttgc tagcttgtgt gctggcagtg acggtgactg tgttgcatcc ggacttcacc ctgaggctgg ctacccaggc actcagccag ctccatgccc ggccatccta ccaccgtctt cgagaggatg tcatgcggct ctctcgccta gcactgggct cagaggcctg gcgccgagtc tggagccgca gtctgcagct ggcgagttgg ccaaaccggg gaggggcacc tggagctccc cagggtgacc ctatgagggt attctcagtt aggacccgga gacaggacac tcttcctgaa gcggggcgca gatcagaggc agaagaggag gaggccagga ccatcagagt gacacctgtc aggggccgag agaggctcaa tgaggaggag cctccaggtg ggcaagaccc ttggaaattg ctgaaggagc aagaggagcg gaagaagtgt gtcatctgcc aggaccagag caagacagtg ttgctcctgc cctgccggca tctgtgcctg tgccaggcct gcactgaaat cctgatgcgc caccccgtct accaccgcaa ttgcccgctc tgccgccggg gcatcctgca gaccctcaat gtctacctct ga. It is sometimes possible for the material contained within the vial of "RNF26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
