Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF212 cdna clone

RNF212 cDNA Clone

Gene Names
RNF212; ZHP3
Synonyms
RNF212; RNF212 cDNA Clone; RNF212 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCCAACTGGGTGTTCTGTAATCGCTGCTTCCAGCCGCCCCACAGGACGTCGTGCTTCAGCCTCACCAACTGCGGGCACGTGTACTGCGACGCCTGCCTCGGCAAAGGTAAAAAGAATGAATGCTTGATTTGTAAAGCTCCTTGTCGTACAGTTTTGCTTTCAAAGCATACCGACGCAGATATCCAGGCATTCTTCATGAGCATAGACAGTCTGTGTAAGAAGTACTCCAGGGAAACCTCCCAGATTTTAGAATTTCAAGAAAAACACAGGAAGAGATTGTTAGCCTTCTATAGAGAAAAGATTTCTAGGTTGGAAGAATCCCTTAGGAAGTCAGTGCTGCAGATAGAACAACTACAAAGTATGAGATCATCACAACAAACAGCTTTCAGCACAATAAAAAGTTCAGTTTCAACAAAACCACACGGATGCCTGCTGCAACCTCACTCATCAGCACCCGACAGACTGGAGTCGATGGAAGTTGATCTCTCTCCTTCTCCGATTAGAAAATCTGAGATAGCAGCCGGCCCTGCGAGAATCTCCATGATTAGTCCACCTCAAGATGGACGAATGGGTTGA
Sequence Length
579
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,357 Da
NCBI Official Full Name
Homo sapiens ring finger protein 212, mRNA
NCBI Official Synonym Full Names
ring finger protein 212
NCBI Official Symbol
RNF212
NCBI Official Synonym Symbols
ZHP3
NCBI Protein Information
probable E3 SUMO-protein ligase RNF212
UniProt Protein Name
Probable E3 SUMO-protein ligase RNF212
UniProt Gene Name
RNF212
UniProt Entry Name
RN212_HUMAN

NCBI Description

This gene encodes a RING finger protein that may function as a ubiquitin ligase. The encoded protein may be involved in meiotic recombination. This gene is located within a linkage disequilibrium block and polymorphisms in this gene may influence recombination rates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]

Uniprot Description

RNF212: SUMO E3 ligase that acts as a regulator of crossing-over during meiosis: required to couple chromosome synapsis to the formation of crossover-specific recombination complexes. Localizes to recombination sites and stabilizes meiosis-specific recombination factors, such as MutS-gamma complex proteins (MSH4 and MSH5) and TEX11. May mediate sumoylation of target proteins MSH4 and/or MSH5, leading to enhance their binding to recombination sites. Acts as a limiting factor for crossover designation and/or reinforcement and plays an antagonist role with CCNB1IP1/HEI10 in the regulation of meiotic recombination. 6 human isoforms produced by alternative splicing.

Protein type: Ligase; EC 6.3.2.-; SUMO ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 4p16.3

Cellular Component: synaptonemal complex

Biological Process: chiasma formation; meiotic gene conversion; meiotic recombination

Disease: Recombination Rate Quantitative Trait Locus 1

Research Articles on RNF212

Similar Products

Product Notes

The RNF212 rnf212 (Catalog #AAA1272089) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCCAACT GGGTGTTCTG TAATCGCTGC TTCCAGCCGC CCCACAGGAC GTCGTGCTTC AGCCTCACCA ACTGCGGGCA CGTGTACTGC GACGCCTGCC TCGGCAAAGG TAAAAAGAAT GAATGCTTGA TTTGTAAAGC TCCTTGTCGT ACAGTTTTGC TTTCAAAGCA TACCGACGCA GATATCCAGG CATTCTTCAT GAGCATAGAC AGTCTGTGTA AGAAGTACTC CAGGGAAACC TCCCAGATTT TAGAATTTCA AGAAAAACAC AGGAAGAGAT TGTTAGCCTT CTATAGAGAA AAGATTTCTA GGTTGGAAGA ATCCCTTAGG AAGTCAGTGC TGCAGATAGA ACAACTACAA AGTATGAGAT CATCACAACA AACAGCTTTC AGCACAATAA AAAGTTCAGT TTCAACAAAA CCACACGGAT GCCTGCTGCA ACCTCACTCA TCAGCACCCG ACAGACTGGA GTCGATGGAA GTTGATCTCT CTCCTTCTCC GATTAGAAAA TCTGAGATAG CAGCCGGCCC TGCGAGAATC TCCATGATTA GTCCACCTCA AGATGGACGA ATGGGTTGA. It is sometimes possible for the material contained within the vial of "RNF212, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.